LymeNet Home LymeNet Home Page LymeNet Flash Discussion LymeNet Support Group Database LymeNet Literature Library LymeNet Legal Resources LymeNet Medical & Scientific Abstract Database LymeNet Newsletter Home Page LymeNet Recommended Books LymeNet Tick Pictures Search The LymeNet Site LymeNet Links LymeNet Frequently Asked Questions About The Lyme Disease Network LymeNet Menu

LymeNet on Facebook

LymeNet on Twitter




The Lyme Disease Network receives a commission from Amazon.com for each purchase originating from this site.

When purchasing from Amazon.com, please
click here first.

Thank you.

LymeNet Flash Discussion
Dedicated to the Bachmann Family

LymeNet needs your help:
LymeNet 2020 fund drive


The Lyme Disease Network is a non-profit organization funded by individual donations.

LymeNet Flash
Topic Closed  Topic Closed
Post New Topic  New Poll  
Topic Closed  Topic Closed
my profile | directory login | register | search | faq | forum home

  next oldest topic   next newest topic
» LymeNet Flash » Questions and Discussion » Medical Questions » CDC's Johnson Lies to Discredit Dr Sapi and Advanced Labs Culture Method

 - UBBFriend: Email this page to someone!    
Author Topic: CDC's Johnson Lies to Discredit Dr Sapi and Advanced Labs Culture Method
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Barbara Johnson of CDC, as many of you know, is an arch-Denialist, who uses her powerful public health position to organise counter-moves to discredit important research breakthroughs which contradict the Steerite line.

She recently published a paper claiming Advanced Labs' blood culture method (which has been finding the bacteria in so many chronic Lyme patients) is unreliable, and that Dr Sapi's results were due to lab contamination.

Below Dr Macdonald shows basically how dishonest Johnson and her colleagues have been:


"Improved Borrelia burgdorferi Blood culture Method
Preview: Re: Improved Borrelia burgdorferi Blood culture Method
CDC Critique of Sapi et al Blood Culture for Borrelia in Human Blood:Many Mistakes by the CDC
critique methods and False Conclusions:
_________________________________________________________________________
CDC Analysis of the DNA sequencing Data for the Advanced Labs Blood culture isolates:
by Dr. Barbara Johnson et al.
________________________________________________________________________
An Official CDC critique and an Official CDC accusation of alleged Flawed Advanced Laboratory techniques
resulting in Only 3 genovars instead of 60 + Genovars of Borrelia as reported by Sapi
__________________________________________________________________________
The CDC Analysis is flawed for the reasons posted below and the CDC manuscript must be
withdrawm
_________________________________________________________________________

The Reader of the CDC manuscript will infer that The CDC had in their possession
aliquots of each of the isolates from Advanced Labs
If this is NOT the case.


The CDC may be required to issue a Retraction of theirmanuscript
to clarify this point for the reader and to address the
BLASTn data which follows for a single isolate .
Advanced Laboratories and the CDC agreed had 21 nucleotide mismatches with B31 were present
in the exemplary Isolate. [Isolate JX867376}


CDC analysis of isolate JX86 7376 detected 21 base mismatches with respect to B31
and the Sapi Paper also reported 21 base mismatches with respect to B31 [97% identity with B31]


I did a BLASTn search on isolate JX867376 against all borrelia.

A 100% match was obtained with JX867376 itself as deposited in GenbBank.This is expected
and this 100% match indicates that the 603 bases were correctly entered into the NCBI BLASTn
Search Engine.
-------------------

B31 borrelia complete DNA sequence produced a result with 21 mismatches against Sapi deposit JX867376 for a congruence percentage of 97%
It is interesting that the BLASTn search also revealed 97% matches for the additional Borrelia on Deposit in GenGank:
N40, CA382 ZS7 and multiple numbered haplotypes of Borrelia spp.
A 96% match was noted for multiple genotypes of B. garinii and B. Bavariensis.


So if the truth be told, based on a BLASTn search of all Borrelia in GenBank, it
is very very misleading to state that isolate JX867376 was UNIQUE for B31
as is posted at position 49 in the CDC Table.....AND .....
and to omit any mention of the following borrelia genotypes
which also yielded 97% matches with JX867376 according to BLASTn search.
ST12
N40
ST8
CA382
ST4
ST51
ST56
St1
ZS7


Each and every one of the above genotypes should have been posted at postion 49 in the CDC table.


To post only B31 is very misleading to the reader who does not use the BLASTn tool
for sequence analysis and borrelia genotyping.


______________________________________________
Correction to the CDC Table of Results for (97%) [21 base mismatches against reference strain borrelia burgdorferiB31] against Advanced Labs Isolate JX867376.

" This Advanced labs isolate may indicate ANY of the following Borrelia species:
B31, N40,ZS7,ST! ST4, ST8ST12,,ST51,ST56, CA382,
_______________________________________
_______________________________________

Mismatches of Bases by BLASTn analysis should now be initiated for Each and Every Advanced Lab nucleotide sequences
and the original manuscript should be withdrawn and re-written
to accommodate BLASTn search data for each of the Advanced Lab PyrG nucleotide sequences.

I look forward to CDCreconciliation of BLASTn data with the observed Advanced Lab dep[osited nucleotide sequences with the hope that the issue of Contamination of Patient Recovered Borrelia from blood cultures
may be viewed in the full context of BLASTn search Data to embrace all possible borrelia species with
closely matching nucleotide sequences.


The maximum number of polymorphic sites in CDC analysis of the Sapi Data was 21.
CDC speciated only 3 strains of borrelia in Their analysis :
B31 burgdorferi [N=22],
B023 afelii [N=2}, and
Fuji P1 garinii [ n=27]


These assignments conflict with the Sapi paper as follows:
In the Sapi manuscript Table 3 :
Sapi et al reported
5 isolates of Garinii - [ no identical garinii genotypes noted by Sapi }
1 isolate of afzelii Pko [consistent with European type afzelii]
3 kurtenbachii [ all genotypically distinct]
1 americanum and
6 burgdorferi [B31=1] , [ZS7=1} , [ N40=1], { ST1 =1], { ST11 =1}, { St8=1}.

For the remaining: "JX86***** series isolates I will consult the GenBank accessions
as I have for isolate JX867376....
and perform my own Clustal analysis. of nucleotide Base alignments

CDC group registered the following genovars [ your results in parentheses]
among the JX86**** series:
7424 51 polymorphic sites [Called Afzelii B023 by CDC group]
7398 49 polymorphic sites [called Afzelii B023 by CDC group]
7394 43 polymorphic sites { Not classified by CDC group}
7417 42 polymorphic sites [Called Garinii Fuji P1 by CDC group}
7380 42 polymorphic sites {called Garinii Fuji P1 by CDC group}
7378 42 polymorphic sites { Called Garinii Fuji P1 by CDC group}
7379 42 polymorphic sites Called Garinii Fuji P1 by CDC group}

Twenty one isolates with 41 polymorphic sites EACH [ isolates not collated here]
7393 39 polymorphic sites [Called garinii Fuji P1 by CDC group}
7376 21 polymorphic sites [[See above - called B31 burgdorferi by CDC group}}
7419 2 polymorphic sites [ Called burgdorferi B31 by CDC group}

CDC also indicate that CDCS equence analysis yielded
27 Identical isolates of Garinii
2 i dentical isolates of Afzelii.
22 isolates of B31 { with only 2 cases #48 and 49 called B31 burgdorferi with "mismatched" bases : #48 n=1 miusmatch and #49 with 21 mismatches]
So instead of 60+ unique Borrelia genovars, the CDC reduced the Sapi/Advanced Labs results to just 3 genovars
-----------------------------------------------------
I insist the the genotyping of the Advanced Labs GenBank deposits
speaks for heterogeneity of genovars, and reinforces the concept that So called
European type borrelia may very well be now recognized as vectored by USA Ixodid ticks.
Mexico, Central America and Brazil are geographies in which GARINII has been proven
to be vectored by ticks.

To make matters more complex, the Amblyomma family of ticks (Amblyomma cajenesse)
are competent vectors for Garinii infections in the Western Hemisphere.
We need not look to Sea bird migrations to explain USA cases of Ixodid scapulairs
and Amblyomma spp. vectored human infections.

The uniqueness of the Sapi report of Advanced Labs Human Blood culture Borrelia strains
is therefore CORRECT.


No Laboratory Contamination of patient material with any living borrelia ever occurred
European Strains of borrelia were recovered from the blood of USA patients in the
Advanced Labs study of Borrelia blood cultures

Respectfully submitted,
Alan B. MacDonald MD FCAP FASCP
August 16,2013"

Elena Cook

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Keebler
Honored Contributor (25K+ posts)
Member # 12673

Icon 1 posted      Profile for Keebler     Send New Private Message       Edit/Delete Post 
-
Elena,

Thanks so much for this, and for the Dr. MacD comment in your other post today from the NYT article.

So much appreciated that you continue to post such key pieces. So sad, of course, but we really need to know the current events as they unfold just to keep up (though sure wish it were not so necessary).

thanks, again
-

Posts: 48021 | From Tree House | Registered: Jul 2007  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
And didn't we know those liars at the CDC would do this? Evidently there is nothing too low and dishonest for them to do.

Once again you can either believe they are criminally incompetent or evil.

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
Keebler
Honored Contributor (25K+ posts)
Member # 12673

Icon 1 posted      Profile for Keebler     Send New Private Message       Edit/Delete Post 
-
It's just so very lonely and such a terribly rough road, in every phase & aspect of a life with lyme.
-

Posts: 48021 | From Tree House | Registered: Jul 2007  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
Aint that the truth.
Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
TF
Frequent Contributor (5K+ posts)
Member # 14183

Icon 1 posted      Profile for TF     Send New Private Message       Edit/Delete Post 
They made the same types of discrediting statements about Dr. MacDonald's research years ago when he was finding living spirochetes in patients who had been treated for months with antibiotics. The purpose was to get the world not to believe what the man was finding.

No different here. Using same tactics so that they won't look like they have been wrong all of these years.

Posts: 9931 | From Maryland | Registered: Dec 2007  |  IP: Logged | Report this post to a Moderator
BobG
LymeNet Contributor
Member # 39642

Icon 1 posted      Profile for BobG     Send New Private Message       Edit/Delete Post 
Hilarious post for proposed remake of Wizard of Oz posted on CDC Facebook page. Go there to "Like"!
Posts: 360 | From Massachusetts | Registered: Dec 2012  |  IP: Logged | Report this post to a Moderator
lpkayak
Honored Contributor (10K+ posts)
Member # 5230

Icon 1 posted      Profile for lpkayak     Send New Private Message       Edit/Delete Post 
grrrrrrrr. too mad to say anything.

--------------------
Lyme? Its complicated. Educate yourself.

Posts: 13712 | From new england | Registered: Feb 2004  |  IP: Logged | Report this post to a Moderator
Catgirl
Frequent Contributor (5K+ posts)
Member # 31149

Icon 1 posted      Profile for Catgirl     Send New Private Message       Edit/Delete Post 
Typical. They have brain issues. I'd lay odds the right side of their brains are barely functioning, which would explain why they cannot think outside the box.

So maybe the right brained people will live longer because we're open minded and smart enough to treat, and the left brains will die off from disease (evolution). Surely, something is not functioning properly in their brains.

--------------------
--Keep an open mind about everything. Also, remember to visit ACTIVISM (we can change things together).

Posts: 5418 | From earth | Registered: Mar 2011  |  IP: Logged | Report this post to a Moderator
OtterJ
LymeNet Contributor
Member # 30701

Icon 1 posted      Profile for OtterJ     Send New Private Message       Edit/Delete Post 
This is reading like a graphic novel with underground lyme warriors fighting for justice. What

is the next step? MacD had written a well reasoned argument as to why CDC is wrong. So, now what?
Also, "Grrrrrr!"

Posts: 482 | From Oregon | Registered: Feb 2011  |  IP: Logged | Report this post to a Moderator
Razzle
Frequent Contributor (1K+ posts)
Member # 30398

Icon 1 posted      Profile for Razzle     Send New Private Message       Edit/Delete Post 
They're blinded by greed, ego, and politics.

--------------------
-Razzle
Lyme IgM IGeneX Pos. 18+++, 23-25+, 30++, 31+, 34++, 39 IND, 83-93 IND; IgG IGeneX Neg. 30+, 39 IND; Mayo/CDC Pos. IgM 23+, 39+; IgG Mayo/CDC Neg. band 41+; Bart. (clinical dx; Fry Labs neg. for all coinfections), sx >30 yrs.

Posts: 4166 | From WA | Registered: Feb 2011  |  IP: Logged | Report this post to a Moderator
Shiela
LymeNet Contributor
Member # 28681

Icon 1 posted      Profile for Shiela     Send New Private Message       Edit/Delete Post 
I hope Dr. MacD does another youtube in response. I don't know why he can't sue them for liable.

--------------------
I'm not there yet but I'm closer than I was yesterday.----
Lyme Band 31,41,58. Being treated for Lyme and Bartonella.

Posts: 149 | From Maine | Registered: Oct 2010  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
I have always felt that we cannot win this war through science alone. We are not dealing with honest people. We do need a political expose of these liars.

CDC will use American taxpayers' money to ensure that their flawed article gets as wide an audience as possible - I would not even be surprised if they arrange for it to go out via mainstream mass media as well as medical media.

Meanwhile they will manoeuvre and use their enormous influence to try and deny Dr Macdonald, Dr Sapi or anyone else who would clarify the issues, access to the medical press.

If any of you had a positive from Advanced Labs and are now facing a skeptical GP or Infectious Disease specialist, why not print out Dr Macdonald's post and invite them to do the Blastn search themselves, and see who is telling the truth.

Elena

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Catgirl
Frequent Contributor (5K+ posts)
Member # 31149

Icon 1 posted      Profile for Catgirl     Send New Private Message       Edit/Delete Post 
http://www.medsci.org/v10p0362.htm

--------------------
--Keep an open mind about everything. Also, remember to visit ACTIVISM (we can change things together).

Posts: 5418 | From earth | Registered: Mar 2011  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Dr Sapi found that a large number of her US patient blood samples contained Borrelia which were closely matched to a Japanese strain of Borrelia garinii called HP1.

This is NOT one of the lab test strains so there is no possibility of contamination.

If you are familiar with using BLASTn, please go there and input the accession number of borrelia HP1 which is AB555778.

Please confirm that you get the output below which confirms Dr Sapi's findings and indicate that CDC's allegation that many of her cultured strains were derived from lab strain garinii Fuji P1 as totally misleading.

Please copy your result here so that everyone can see.
Thanks
Elena
ps The size of the display box in Lymenet may distort some of the blast columns. If you recopy the text into Word this may help.

NCBI LogoBLAST ®
Basic Local Alignment Search Tool
My NCBI My NCBI help
[Sign In] [Register]
Jump to Page Content

Home
Recent Results
Saved Strategies
Help

NCBI/ BLAST/ blastn suite/ Formatting Results - 19ZZM4SR015

Edit and Resubmit Save Search Strategies Formatting options Download How to read this page Blast report description

dbj|AB555778| (603 letters)

Query ID
gi|333775868|dbj|AB555778.1|
Description
Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HP1
Molecule type
nucleic acid
Query Length
603

Database Name
nr
Description
Nucleotide collection (nt)
Program
BLASTN 2.2.28+ Citation


Other reports: Search Summary [Taxonomy reports] [Distance tree of results]
Graphic Summary
Distribution of 100 Blast Hits on the Query Sequence




score 1160
score 1160
score 1154
score 1154
score 1154
score 1154
score 1154
score 1148
score 1148
score 1142
score 1142
score 1142
score 1142
score 1136
score 1136
score 1136
score 1136
score 1136
score 1136
score 1136
score 1136
score 1136
score 1131
score 1131
score 1131
score 1131
score 1131
score 1131
score 1131
score 1131
score 1125
score 1125
score 1125
score 1125
score 1125
score 1125
score 1125
score 1119
score 1119
score 1119
score 1119
score 1119
score 1119
score 1113
score 1113
score 1113
score 1108
score 1102
score 1102
score 1096
score 1096
score 1096
score 1096
score 1096
score 1096
score 1096
Descriptions
Sequences producing significant alignments:
Select:AllNone Selected:0
Alignments Download GenBank Graphics Distance tree of results Show/hide columns of the table presenting sequences producing significant alignments
Sequences producing significant alignments: Select for downloading or viewing reports Description Max score Total score Query cover E value Ident Accession

Borrelia garinii strain Ekb704-11 CTP synthase (pyrG) gene, partial cds
1160 1160 100% 0.0 100% JX971327.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HP1 >gb|JX867375.1| Borrelia sp. enrichment culture clone r76pg CTP synthase (pyrG) gene, partial cds >gb|JX867401.1| Borrelia sp. enrichment culture clone c385pg CTP synthase (pyrG) gene, partial cds >gb|JX867402.1| Borrelia sp. enrichment culture clone c392pg CTP synthase (pyrG) gene, partial cds >gb|JX867403.1| Borrelia sp. enrichment culture clone c423pg CTP synthase (pyrG) gene, partial cds >gb|JX867404.1| Borrelia sp. enrichment culture clone c428pg CTP synthase (pyrG) gene, partial cds >gb|JX867406.1| Borrelia sp. enrichment culture clone c462pg CTP synthase (pyrG) gene, partial cds >gb|JX867407.1| Borrelia sp. enrichment culture clone c463pg CTP synthase (pyrG) gene, partial cds >gb|JX867408.1| Borrelia sp. enrichment culture clone c467pg CTP synthase (pyrG) gene, partial cds >gb|JX867409.1| Borrelia sp. enrichment culture clone c473pg CTP synthase (pyrG) gene, partial cds >gb|JX867410.1| Borrelia sp. enrichment culture clone c490pg CTP synthase (pyrG) gene, partial cds >gb|JX867412.1| Borrelia sp. enrichment culture clone c517pg CTP synthase (pyrG) gene, partial cds >gb|JX867413.1| Borrelia sp. enrichment culture clone c528pg CTP synthase (pyrG) gene, partial cds >gb|JX867414.1| Borrelia sp. enrichment culture clone c537pg CTP synthase (pyrG) gene, partial cds >gb|JX867415.1| Borrelia sp. enrichment culture clone c549pg CTP synthase (pyrG) gene, partial cds >gb|JX867416.1| Borrelia sp. enrichment culture clone c555pg CTP synthase (pyrG) gene, partial cds >gb|JX867418.1| Borrelia sp. enrichment culture clone c614pg CTP synthase (pyrG) gene, partial cds >gb|JX867420.1| Borrelia sp. enrichment culture clone c649pg CTP synthase (pyrG) gene, partial cds >gb|JX867421.1| Borrelia sp. enrichment culture clone c656pg CTP synthase (pyrG) gene, partial cds >gb|JX867422.1| Borrelia sp. enrichment culture clone c677pg CTP synthase (pyrG) gene, partial cds >gb|JX867423.1| Borrelia sp. enrichment culture clone c693pg CTP synthase (pyrG) gene, partial cds
1160 1160 100% 0.0 100% AB555778.1

Borrelia sp. enrichment culture clone c612pg CTP synthase (pyrG) gene, partial cds
1154 1154 100% 0.0 99% JX867417.1

Borrelia sp. enrichment culture clone c503pg CTP synthase (pyrG) gene, partial cds
1154 1154 100% 0.0 99% JX867411.1

Borrelia sp. enrichment culture clone c113pg CTP synthase (pyrG) gene, partial cds
1154 1154 100% 0.0 99% JX867380.1

Borrelia sp. enrichment culture clone c112pg CTP synthase (pyrG) gene, partial cds
1154 1154 100% 0.0 99% JX867379.1

Borrelia sp. enrichment culture clone c63pg CTP synthase (pyrG) gene, partial cds
1154 1154 100% 0.0 99% JX867378.1

Borrelia sp. enrichment culture clone c204pg CTP synthase (pyrG) gene, partial cds
1148 1148 100% 0.0 99% JX867394.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NP76 >dbj|AB556338.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-21 >dbj|AB556386.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-38
1148 1148 100% 0.0 99% AB555834.1

Borrelia sp. enrichment culture clone c198pg CTP synthase (pyrG) gene, partial cds
1142 1142 99% 0.0 99% JX867393.1

Borrelia garinii strain ConnA3/3 PyrG (pyrG) gene, partial cds
1142 1142 100% 0.0 99% JF331269.1

Borrelia garinii strain T1697 PyrG (pyrG) gene, partial cds
1142 1142 100% 0.0 99% JF331231.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HT18
1142 1142 100% 0.0 99% AB555794.1

Borrelia garinii strain IPT114 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331265.1

Borrelia garinii strain T2885 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331259.1

Borrelia garinii strain T2712 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331258.1

Borrelia garinii strain T1866 PyrG (pyrG) gene, partial cds >gb|JF331245.1| Borrelia garinii strain T1867 PyrG (pyrG) gene, partial cds >gb|JF331246.1| Borrelia garinii strain T1869 PyrG (pyrG) gene, partial cds >gb|JF331247.1| Borrelia garinii strain T1874 PyrG (pyrG) gene, partial cds >gb|JF331248.1| Borrelia garinii strain T1913 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331244.1

Borrelia garinii strain T1673 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331229.1

Borrelia garinii strain T1667 PyrG (pyrG) gene, partial cds >gb|JF331235.1| Borrelia garinii strain T1727 PyrG (pyrG) gene, partial cds >gb|JF331236.1| Borrelia garinii strain T1789 PyrG (pyrG) gene, partial cds >gb|JF331237.1| Borrelia garinii strain T1793 PyrG (pyrG) gene, partial cds >gb|JF331238.1| Borrelia garinii strain T1794 PyrG (pyrG) gene, partial cds >gb|JF331239.1| Borrelia garinii strain T1795 PyrG (pyrG) gene, partial cds >gb|JF331240.1| Borrelia garinii strain T1796 PyrG (pyrG) gene, partial cds >gb|JF331241.1| Borrelia garinii strain T1798 PyrG (pyrG) gene, partial cds >gb|JF331242.1| Borrelia garinii strain T1799 PyrG (pyrG) gene, partial cds >gb|JF331243.1| Borrelia garinii strain T1815 PyrG (pyrG) gene, partial cds >gb|JF331251.1| Borrelia garinii strain T2017 PyrG (pyrG) gene, partial cds >gb|JF331252.1| Borrelia garinii strain T2021 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331227.1

Borrelia garinii strain T1666 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331226.1

Borrelia garinii strain T1131 PyrG (pyrG) gene, partial cds
1136 1136 100% 0.0 99% JF331222.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HT59 >dbj|AB555866.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NT31
1136 1136 100% 0.0 99% AB555802.1

Borrelia garinii isolate Ekb709-11 CTP synthase (pyrG) gene, partial cds
1131 1131 100% 0.0 99% JX971348.1

Borrelia garinii strain Ekb706-11 CTP synthase (pyrG) gene, partial cds
1131 1131 100% 0.0 99% JX971328.1

Borrelia garinii strain Ekb701-11 CTP synthase (pyrG) gene, partial cds
1131 1131 100% 0.0 99% JX971326.1

Borrelia garinii strain CNE 83 PyrG (pyrG) gene, partial cds
1131 1131 100% 0.0 99% JF331273.1

Borrelia garinii strain T1669 PyrG (pyrG) gene, partial cds >gb|JF331250.1| Borrelia garinii strain T1940 PyrG (pyrG) gene, partial cds >gb|JF331255.1| Borrelia garinii strain T2024 PyrG (pyrG) gene, partial cds >gb|JF331256.1| Borrelia garinii strain T2299 PyrG (pyrG) gene, partial cds
1131 1131 100% 0.0 99% JF331228.1

Borrelia garinii strain T1638 PyrG (pyrG) gene, partial cds
1131 1131 100% 0.0 99% JF331224.1

Borrelia garinii strain T1377 PyrG (pyrG) gene, partial cds
1131 1131 100% 0.0 99% JF331223.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkIP2
1131 1131 100% 0.0 99% AB555770.1

Borrelia garinii strain IPT156 PyrG (pyrG) gene, partial cds >gb|JF331267.1| Borrelia garinii strain IPT167 PyrG (pyrG) gene, partial cds >gb|JF331268.1| Borrelia garinii strain IPT189 PyrG (pyrG) gene, partial cds >gb|JF331270.1| Borrelia garinii strain G25 PyrG (pyrG) gene, partial cds >gb|JF331271.1| Borrelia garinii strain 152-B17 PyrG (pyrG) gene, partial cds >gb|JF331272.1| Borrelia garinii strain BR-14 PyrG (pyrG) gene, partial cds
1125 1125 100% 0.0 99% JF331266.1

Borrelia garinii strain IPT28 PyrG (pyrG) gene, partial cds
1125 1125 100% 0.0 99% JF331264.1

Borrelia garinii strain T2645 PyrG (pyrG) gene, partial cds
1125 1125 100% 0.0 99% JF331257.1

Borrelia garinii strain T1699 PyrG (pyrG) gene, partial cds >gb|JF331233.1| Borrelia garinii strain T1708 PyrG (pyrG) gene, partial cds >gb|JF331249.1| Borrelia garinii strain T1938 PyrG (pyrG) gene, partial cds >gb|JF331254.1| Borrelia garinii strain T2023 PyrG (pyrG) gene, partial cds
1125 1125 100% 0.0 99% JF331232.1

Borrelia garinii strain T1656 PyrG (pyrG) gene, partial cds
1125 1125 100% 0.0 99% JF331225.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: Np189
1125 1125 100% 0.0 99% AB555898.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NP81 >dbj|AB555882.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: Ip-90
1125 1125 100% 0.0 99% AB555842.1

Borrelia bavariensis strain Prm7569-11 CTP synthase (pyrG) gene, partial cds
1119 1119 100% 0.0 99% JX971334.1

Borrelia garinii strain T2929 PyrG (pyrG) gene, partial cds
1119 1119 100% 0.0 99% JF331261.1

Borrelia garinii strain T1712 PyrG (pyrG) gene, partial cds
1119 1119 100% 0.0 99% JF331234.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: Mp7 >dbj|AB556146.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR7 >dbj|AB556186.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: FsAE1 >dbj|AB556234.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HokkaidoAS7B >dbj|AB556242.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: ASF >dbj|AB556410.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-41
1119 1119 100% 0.0 99% AB555890.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NT25
1119 1119 100% 0.0 99% AB555858.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HP3
1119 1119 100% 0.0 99% AB555786.1

Borrelia garinii strain T2022 PyrG (pyrG) gene, partial cds
1113 1113 100% 0.0 99% JF331253.1

Borrelia garinii strain T1682 PyrG (pyrG) gene, partial cds
1113 1113 100% 0.0 99% JF331230.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-37
1113 1113 100% 0.0 99% AB556378.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NP8
1108 1108 100% 0.0 99% AB555826.1

Borrelia garinii strain Ekb712-11 CTP synthase (pyrG) gene, partial cds
1102 1102 100% 0.0 98% JX971329.1

Borrelia garinii strain T2916 PyrG (pyrG) gene, partial cds
1102 1102 100% 0.0 98% JF331260.1

Borrelia bavariensis strain PZwi CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833620.1

Borrelia bavariensis strain PWin CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833619.1

Borrelia bavariensis strain PTrob CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833618.1

Borrelia bavariensis strain PSh CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833617.1

Borrelia bavariensis strain PScf CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833616.1

Borrelia bavariensis strain PRof CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833615.1

Borrelia bavariensis strain PRab CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833614.1

Borrelia bavariensis strain POb CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833613.1

Borrelia bavariensis strain PNi CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833612.1

Borrelia bavariensis strain PNeb CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833611.1

Borrelia bavariensis strain PMch CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833610.1

Borrelia bavariensis strain PHoe CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833609.1

Borrelia bavariensis strain PFo CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833608.1

Borrelia bavariensis strain PFlk CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833607.1

Borrelia bavariensis strain PFin CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833606.1

Borrelia bavariensis strain PFei CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833605.1

Borrelia bavariensis strain PBN CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833604.1

Borrelia bavariensis strain PBar CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833603.1

Borrelia bavariensis strain PBaeI CTP synthase (pyrG) gene, partial cds
1096 1096 100% 0.0 98% KC833602.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NP4
1096 1096 100% 0.0 98% AB555818.1

Borrelia garinii PBi, complete genome
1096 1096 100% 0.0 98% CP000013.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-15
1090 1090 100% 0.0 98% AB556298.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: N346 >dbj|AB556394.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-39
1085 1085 100% 0.0 98% AB555810.1

Borrelia bavariensis isolate Krg1090-09 CTP synthase (pyrG) gene, partial cds
1079 1079 100% 0.0 98% JX971349.1

Borrelia bavariensis isolate Arh976-12 CTP synthase (pyrG) gene, partial cds
1079 1079 100% 0.0 98% JX971346.1

Borrelia bavariensis strain Prm7564-11 CTP synthase (pyrG) gene, partial cds
1079 1079 100% 0.0 98% JX971331.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-20T
1079 1079 98% 0.0 98% AB556330.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkIP1 >dbj|AB556194.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: FsAE2 >dbj|AB556210.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: sai6B >dbj|AB556282.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: Hiratsuka >dbj|AB556314.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-17 >dbj|AB556402.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-40 >dbj|AB556418.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-42
1079 1079 100% 0.0 98% AB555762.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HH1
1073 1073 100% 0.0 98% AB556426.1

Borrelia garinii NMJW1, complete genome
1067 1067 100% 0.0 97% CP003866.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NT24 >dbj|AB555874.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: FujiP2 >dbj|AB556106.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR1 >dbj|AB556130.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR5 >dbj|AB556138.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR6 >dbj|AB556162.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR11 >dbj|AB556170.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR12 >dbj|AB556202.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: FiEE11 >dbj|AB556218.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: sai7B >dbj|AB556226.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: sai8E >dbj|AB556250.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: ChYAE2 >dbj|AB556266.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: CTA4a >dbj|AB556290.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-14 >dbj|AB556322.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-18 >dbj|AB556346.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-32 >dbj|AB556354.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-33 >dbj|AB556362.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-34 >dbj|AB556370.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-35
1067 1067 100% 0.0 97% AB555850.1

Borrelia bavariensis isolate Alt756-11 CTP synthase (pyrG) gene, partial cds
1062 1062 100% 0.0 97% JX971337.1

Borrelia bavariensis isolate Krv750-11 CTP synthase (pyrG) gene, partial cds
1062 1062 100% 0.0 97% JX971336.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: CTA5b
1062 1062 100% 0.0 97% AB556274.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: CTA1b
1062 1062 100% 0.0 97% AB556258.1

Borrelia bavariensis isolate Ekb166-10 CTP synthase (pyrG) gene, partial cds
1056 1056 100% 0.0 97% JX971342.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: J-16
1056 1056 100% 0.0 97% AB556306.1

Borrelia bavariensis isolate Alt763-11 CTP synthase (pyrG) gene, partial cds
1044 1044 100% 0.0 97% JX971341.1

Borrelia garinii BgVir chromosome linear, complete sequence
1044 1044 100% 0.0 97% CP003151.1

Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR3 >dbj|AB556122.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR4 >dbj|AB556154.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HkCR9 >dbj|AB556178.1| Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HokkaidoCRB35B
1044 1044 100% 0.0 97% AB556114.1

Borrelia garinii strain T3221 PyrG (pyrG) gene, partial cds
1033 1033 100% 0.0 96% JF331263.1

Borrelia garinii strain T2937 PyrG (pyrG) gene, partial cds
1033 1033 100% 0.0 96% JF331262.1

Borrelia sp. enrichment culture clone r79pg CTP synthase (pyrG) gene, partial cds
998 998 98% 0.0 96% JX867376.1

Borrelia bissettii pyrG gene for CTP synthase, partial cds
940 940 98% 0.0 94% AB526143.1

Borrelia afzelii PKo, complete genome
935 935 98% 0.0 94% CP002933.1

Borrelia afzelii PKo, complete genome
935 935 98% 0.0 94% CP000395.1

Borrelia afzelii isolate Arh997-12 CTP synthase (pyrG) gene, partial cds
929 929 98% 0.0 94% JX971347.1

Borrelia afzelii isolate Arh974-12 CTP synthase (pyrG) gene, partial cds
929 929 98% 0.0 94% JX971345.1

Borrelia afzelii isolate Arh948-12 CTP synthase (pyrG) gene, partial cds
929 929 98% 0.0 94% JX971344.1

Borrelia afzelii isolate Prm7050-12 CTP synthase (pyrG) gene, partial cds
929 929 98% 0.0 94% JX971343.1

Borrelia afzelii isolate Alt730-11 CTP synthase (pyrG) gene, partial cds
929 929 98% 0.0 94% JX971340.1
Alignments
Download GenBankGraphics Next Previous Descriptions
Borrelia garinii strain Ekb704-11 CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX971327.1|Length: 603Number of Matches: 1
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1160 bits(603) 0.0 603/603(100%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: HP1
Sequence ID: dbj|AB555778.1|Length: 603Number of Matches: 1
See 20 more title(s)
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1160 bits(603) 0.0 603/603(100%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia sp. enrichment culture clone c612pg CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX867417.1|Length: 603Number of Matches: 1
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1154 bits(600) 0.0 602/603(99%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTTAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia sp. enrichment culture clone c503pg CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX867411.1|Length: 603Number of Matches: 1
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1154 bits(600) 0.0 602/603(99%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCTTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia sp. enrichment culture clone c113pg CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX867380.1|Length: 603Number of Matches: 1
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1154 bits(600) 0.0 602/603(99%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAGGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia sp. enrichment culture clone c112pg CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX867379.1|Length: 603Number of Matches: 1
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1154 bits(600) 0.0 602/603(99%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATCGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia sp. enrichment culture clone c63pg CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX867378.1|Length: 603Number of Matches: 1
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1154 bits(600) 0.0 602/603(99%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTCCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia sp. enrichment culture clone c204pg CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX867394.1|Length: 603Number of Matches: 1
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1148 bits(597) 0.0 601/603(99%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAGAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAGCTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia garinii pyrG gene for CTP synthase, partial cds, isolate: NP76
Sequence ID: dbj|AB555834.1|Length: 603Number of Matches: 1
See 2 more title(s)
Related Information
Range 1: 1 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1148 bits(597) 0.0 601/603(99%) 0/603(0%) Plus/Plus

Query 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 GGAAGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAAT 60

Query 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 GAGCAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTC 120

Query 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CCCGATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTG 180

Query 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GCAATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATT 240

Query 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TATGAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTG 300

Query 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCT 360
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct 301 AATATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGTAGGAGTTATAAAATCT 360

Query 361 AAtttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 AATTTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTT 420

Query 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GATGATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTA 480

Query 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 CTTATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTT 540

Query 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCT 600
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GACGGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCC 600

Query 601 ATT 603
|||
Sbjct 601 ATT 603


Download GenBankGraphics Next Previous Descriptions
Borrelia sp. enrichment culture clone c198pg CTP synthase (pyrG) gene, partial cds
Sequence ID: gb|JX867393.1|Length: 603Number of Matches: 1
Related Information
Range 1: 4 to 603GenBankGraphics Next Match Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
1142 bits(594) 0.0 598/600(99%) 0/600(0%) Plus/Plus

Query 4 AGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAATGAG 63
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 4 AGCAGCAATATTGCTTTTATTCATTTAACCTATGTACCAAGTCCAGCTGGAATTAATGAG 63

Query 64 CAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTCCCC 123
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 64 CAAAAATCTAAACCCACTCAACAGAGTGTTAAAACTTTAAATAAAGCAGGCATTTTCCCC 123

Query 124 GATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGaaaaaaaGTGGCA 183
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 124 GATCTGATTATTGCTAGAAGCTCTCAAGTATTAACAGATCAAATCAGAAAAAAAGTGGCA 183

Query 184 ATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATTTAT 243
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 184 ATGTTTTGTAATGTTGAGAGCACTTCTATTATTGATAATATTGATGTTTCTACTATTTAT 243

Query 244 GAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTGAAT 303
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 244 GAAATTCCTATATCTTTTTACAAACAAGGCGTACATGAGATTTTAAGTTCTAAGTTGAAT 303

Query 304 ATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCTAAt 363
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 304 ATCAAGGTTGATCCAAAAATAGAAGAGCTTTCAAAGCTTGCAGGAGTTATAAAATCTAAT 363

Query 364 ttttttGCGCCTaaaaaaaTTATTAATATTGCCATTTGTGGTAAATATGCTGAACTTGAT 423
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 364 TTTTTTGCGCCTAAAAAAATTATTAATATTGCCATTTGTGGTAAATATGCTGAACTTGAT 423

Query 424 GATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCTAATTTGGACTTACTT 483
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct 424 GATTCTTATGCGTCAATTCGAGAGTCTTTGGTTCATGTTGGAGCCAATTTGGACTTACTT 483

Query 484 ATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTTGAC 543
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 484 ATTAAAAGCACTCTAATTGATTCTAATGATTTAAATGAGAGTTATTTAAAAGAGTTTGAC 543

Query 544 GGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATTGCTATT 603
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct 544 GGCATTATTGTTCCCGGCGGCTTTGGGGGGAAAGGATATGAGGGTAAAATTATGGCTATT 603


BLAST is a registered trademark of the National Library of Medicine.

NCBI | NLM | NIH | DHHS

Copyright | Disclaimer | Privacy | Accessibility | Contact | Send feedback


quote:
Originally posted by Catgirl:
http://www.medsci.org/v10p0362.htm



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Rivendell
Frequent Contributor (1K+ posts)
Member # 19922

Icon 1 posted      Profile for Rivendell     Send New Private Message       Edit/Delete Post 
Well, I'm not surprised.

The CDC said the lab results showing the recent virus found in so many with CFS was contaminated.
(Was it called XMRV? Can't remember)

And the CDC shot down any notion that Morgellon's disease was real by doing lousy research.

Crazy!

Posts: 1358 | From Midwest | Registered: Apr 2009  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Good afternoon Mr lhctom,

Welcome to LymeNet! Here it is customary to say "hello" first, to introduce yourself, rather than begin by saying you're "no CDC fan". There is no need to be so defensive. I, for one, believe that you may not be a CDC fan. After all, there is plenty of rivalry between CDC and NIH.

I was wondering when you would turn up.

You ignore the Blast output I have posted, and say you are "troubled" by Dr Sapi's results. You fear she found no Lyme at all, just contamination.

Well, I am going to ease you're troubled mind, Mr 1hctom. And this time, I will do it in a manner that everyone here will understand, even if they have never studied science in their entire lives.

So please, come, sit at our table; it's so cold outside - here it's comfortable. Relax, make yourself at home, make yourself at ease. Let us take your troubles from you....

Je vous connais milord...

Now. Mr Ihctom please explain to me, how did Dr Sapi manage to contaminate her cultures, when the live control strains she used were stored in a different lab, which was situated IN A DIFFERENT STATE?

There, you feel less troubled already, don't you, Mr "lkctom"? Don't you feel the stress just melting away?

I'm so glad we have been able to relieve you of your "troubles".

Friends (that's not you, Mr Ihctom), please do not report him to the moderator this time round.

I know some of you find it unbearable to be in the same corner of cyberspace as him. Believe me, I feel exactly the same as you. But let's give the miserable rodent a chance. He is going to explain to us how the live control strains of Borrelia managed to transport themselves from one state to another, just to contaminate Dr Sapi's cultures.

So tell us, Mr 1hctom. Please. Explain it to us. We are burning to know. Did the germs hitch-hike? Take a plane? I haven't been to the States in so many years. Do you still have Greyhound buses? If so, perhaps the strains hopped on a Greyhound bus? You tell us, Mr Ihctom. Enlighten us.

It's so much better to have an open debate, don't you think? Let us all put our cards on the table. So much more honourable than a government official hacking into people's Medscape accounts, desperately trying to stop certain borrelia-related facts from reaching a medical audience, don't you think?. Of course you would never stoop to such pathetic behaviour, would you, Mr 1hctom. No. Of course not.

So tell us. How did the lab strains transport themselves from one lab to the other? Tele-transport, like Star Trek?

Elena Cook


quote:
Originally posted by lhctom:
I'm no CDC fan but its troubling that 29 patients from across the US were found to have the garinii species not found in the US and at least 21 had the exact same 603 letter pyrG gene that also matched the Japanese JujiP2 garinii strain that was acquired by ALS and used to test the culture.

The odds of finding so high a percentage of garinii infections in the US is quite low. The odds of spirochetes from multiple US sites having the exact same 603 letters in their pyrG gene is even lower. To have 21 matches to the 603 letters of the ATCC test FujiP2 isolate is very low. The odds all three would happen is the product of the three very low odds. This is not good.



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
All this is Greek to me - could someone explain?

I was positive on the ALS test.

Results from my four Igenex tests are in my sig. line. Lots of bands - from different tests dates - considered negative.

I think the ALS confirmed I have Lyme.

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
Am tired - will try to reply.

My lifestyle was riding horses, walking dogs, birdwatching/hiking etc in the woods. Have pulled ticks off all my animals. And myself.

No rash. I feel I was infected in Texas.
About a year ago it was in the news that Texas A&M
Univ. was testing ticks throughout the state. 25% tested pos. for Bb.

I knew I was sick. Weird bad sick/symptoms. Started with my eyes and mouth getting dry and eyes very sensitive to light. Tested neg. to everything.

First test with Igenex came back with some pos. and Ind bands. So tested and re-tested after various challenges. Some bands repeated. Some only appeared on one test result.

I did the HLA tests and I fit the group for Lyme susceptible. Bad detoxer etc.

CD57 low.

Discovered I also have Hypogammaglobulinemia.
ie deficient amounts of total serum Imm.G and subclasses.

Perhaps caused by Lyme disease?

Perhaps is why so few IGG bands?

So I begged for the ALS culture test. To my surprise - because I had really given up - the tenth week I got the call that I was positive.

I suppose I will always have my doubts - that's just me. I have lost faith in about everything having to do with medicine - testing, diagnosis, treatment etc.

Oh - my Bart. Hens. came back from Igenex as positive. Or better said - not negative with IGG of 40 - which under their changed ranges implies positive.

Would be rather hard to believe I had Bart with no Lyme.

Anyway, my pea brain cannot grasp the controversy over the ALS test - and contamination - ???
I cannot connect the dots/understand the techno stuff.

An issue is that a strand of Lyme from another country was detected or something? That is where I get lost. So lost that I cannot even determine if the strain was found in patients' blood or test medium.

As an aside - and unrelated - I found it interesting to read what antibodies were found in different IVIG brands from different manufacturers/countries/donors. IIRC four of the five brands showed Bb antibodies to varying degrees.

Try searching for that info. You won't find it.
I printed a copy years ago. Maybe it is meaningless info - maybe not.

To add; re: sequencing. That part of the culture test was not available when I tested.
I think that was called an "extended" part of the test? Whatever - I really wanted my specimen - if positive - to be "typed". Regret that it wasn't. If the test was not so expensive I would do it again. That IS the part of the ALS test that you are questioning, right?

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
Really tired......
CD57 below 60.

When Cornell came out with their new multiplex Lyme test I had my horse tested - and soooooo wish I could have slipped a tube of my blood in the shipping container.

How can Cornell come up with such an accurate test and no one else can? I wish they would test humans - far less drama.

And BTW my horse was neg. IIRC an antibody test on him prior had band 41.

Reasonably, how many people in the US would test pos. for Bg or Ba? AFAIK TBI's did not originate in the US. Bb got here somehow - as well the others, right?

Who else reading here has had the ALS gene sequencing? Results? Bb? Bg? Ba?

I know I need to research all this more in depth.

My ALS said pos. for Bb - that is all I know.

Geez - could folks have BB and or Bg/Ba?

So really the "exact" matching is the problem?
The results look too much like the test medium?

Really - this needs to be dumbed down for some of us.

Have treated - not aggressively - overall I guess am worse than when I "crashed" in 2006. First "crash" of 1996 was thought to be CFS/EBV/Fibro.

So more studies being done? Results expected when? This does concern me.

Whatever the outcome - the truth would be nice.

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Posted by Dr alan Macdonald on Lyme forums:


Re: Improved Borrelia burgdorferi Blood culture Method
Postby inmacdonald » August 22nd, 2013, 2:21 pm
BLAST searches are good ......[ by that we are speaking of BLASTn or the nucleotide blast,
there are also other BLAST menu choices such as Protein sequence BLAST.....
but for MUTATION DETECTIVES, please use the BLASTn- as it provides
maximum detail]

for Further site by site analysis exquisite Detail of Nucleotides with precision and minimal human Eyeball analysis type errors in scanning sequences of 603 base length...
Always use CLUSTAL analysis. because the Color stripes of like bases (see below link)
allows for easier graphical Locus by Locus analysis [ with no hocus pocus}

.....do the math..for BLASTn RESULTS...
1. BLAST result of 100% match for a sequence of 603 bases = identity of 603 out of 603 bases
Blast result of 99% match for a sequence of 603 bases = Identity of 597 out of 603 bases
Blast result of 97% match for a sequence of 603 bases = identity of 585 out of 603 bases

2. Now for example in a 99% blast identity comparing 2 GenBank depoists, What were the exact LOCus positions in the 603 sequence for each and every on of the the mismatches??
AND what were the letters for each and every locus mismatch at Each site.??

Answers: You can examine the sequence print outs for BLAST for each of the "Found" mismatches.
You will soon go blind trying to manually analyze 100 different retrievals each 603 bases long in BLASTn
Search,
Or You can do Clustal Analysis and get color coded alignments - which highlight the areas of mismatch
among many may DNA sequences, and allow for easy determination of the Specific identity of substitution/mutation
at Each Locus.

Link:
https://www.dropbox.com/s/cguk0mforuqb3 ... 20Labs.pdf

Clustal Analysis for Garinii type DNA sequences including both GenBank Reference Garinii individuual deposits
from around the world
and
For ALL of the Sapi et al GARINII - like isolates in the Advanced Labs blood Culture paper.


Clustal analysis - for Garinii-like isolates From Advanced labs shows:
A. perfect alignments at 100% identity for 21 of the Advanced labs GenBank deposits
and 5 Advanced Lab deposits with Single Base Mismatch [ each a a different locus and Each with a unique base substitution.} and 1 Advanced Labs deposit with TWO Base mismatches
This does not provide evidence for a "cookie cutter" population of Garinii-like isolates,
but rather shows mutated bases in 6 of27 Advanced lab deposits
For an overall rate of 22% of Advanced labs deposits Positive for mutations
against reference garinii strain AB55778 ( haplotype 603 base deposit Garinii Hp10)

Among the remaining Garinii 603 base haplotype deposits Jf331248.1, JF331231.1, JF 331269.1
and JF331265.1 Identities of 100% were seen in this group of Four reference garinii strains.
This identical group of four Garinii had 166/603 mismatches with the Advanced labs deposits.
There is no reason to suspect that 105 dna sequence identity among the "group of four"
was a result of "Contamination".
The Lab of Origin, Date of Deposit,and Source of the Deposit(isolated from what life form)for the "Group of Four" are as follows:
JF331248.1 Gomez-Diaz, Barcelona,spain/Feb 15,2011/ Ixodes uriae tick/ strain name T1913
JF331231.1 Gomez-Diaz,Barcelona,Spain/Feb15,2011/ Ixodes uriae tick/ strain name T1697
JF331269.1 Gomez-Diaz, Barcelona, Spain/ Feb 15,2011/ Ixodes uriae tick / strain name Conn A3/3
JF331265.1 Gomez-Diaz, Barcelona, Spain / Feb13, 2011/ IXODES RICINUS tick/strain name IPT114
So Four separate Garinii isolates from Spain with 100% identity in the "group of Four" - with separate tick species
showing 100% identity in DNA from Garinii strains (4 different) recovered.
-------------------------------------------------------------------------------------------------------------

Ref: Gomez-diaz, E ,et al, "Genetic structure of marine borrelia garinii and population admixture with
terrestrial cycle of Lyme borreliosis", 2011, Environ.Microb. 13(9):2453-67.
________________________________________________________________________________________
Now a source for the GenBank reference Strain HP1 of Garinii GenBank AB555778.1 which shows extensive
100% identity with the Advanced Labs human blood borrelia isolates [ 21 cases out of 27]

Source of this specimen:
Fujita, H, et al, HokKaido Japan/ April 12, 2010/ Ixodes persulcatus tick / strain name HP1

There is no possibility of contamination of any of the Advanced labs Isolates with this Garinii HP1
since it is Not for SALE at the American Type Culture Collection.[ATCC}
That is correct!! Not For Sale!!! Not available in any store !!!

Plain and simple:
Contamination did not occur in Barcelona ,Spain in the lab of Gomez-Diaz in year 2011.
[ 100% identities of 603 bases from the group of four" notwithstanding]
Contamination did not occur in Philadelphia, Pennsylvania Advanced labs in the year 2012-2013.
[ 100% identities of 603 bases in the group of 21 notwithsatnding.
{ 6 Advanced labs human blood culture isolates showed mutations which make them Unique
among ALL GARINII Deposits in the National Center for biotechnology Information(NCBI) }

Let us get used to the concept that GARINII type borrelia are present in the blood of some USA patients who
acquired Lyme disease , chronic type,and who were willing to spend upwards of $1000.00 to secure
this precious information.


Respectfully submitted,
Alan B. MacDonald, MD, FCAP, FASCP
August 22,2010

PS:
Yes many,many words in the CDC paper:
"Assessment of New Culture Method to Detect Borrelia species in Serum of Lyme Disease Patients"
Barbara J.B. Johnson, Mark A. Pilgard, and Theresa M. Russsell
J. Clin Micro ,14 Aug 2013 epub ahead of print, doi 10.1128/JCM.01674-13
Are False statements, not buttressed by Bench laboratory work by any of the authors,
who as CDC employees [ as listed on the title Page} represent the full force and power
of the Centers for Disease Control and Prevention.

Collectively, the authors of the CDC official critique of a legitimate private Scientific Laboratory,
Licensed and certified by the State of Pennsylvania to provide diagnostic medical services to
patients, engaged in concerted action to Discredit Advanced Laboratories.
The CDC employees FABRICATED mis-truths and engaged in Unsubstantiated Speculation that
Advanced labs had living Borrelia in the building which houses the Advanced Laboratories facility.
Furthermore, the CDC employees speculated, without ever conducting a Site visit to the Advanced
laboratories Facilities, that carelessness in laboratory technique CAUSED results to be issued to
patients and to the physicians caring for them.

Finally, the employees of the CDC who authored the above captioned paper gave written instructions
to patients concerning their medical care based on laboratory clinical diagnostic reports to disregard
the Advanced Laboratories results as spurious, flawed and misleading. All of this from CDC employees
holding positions of highest authority, without ever Fact checking the accusations made in their paper.

So did the CDC authors write untruths? Yes
Should disciplinary action be taken against CDC employees , who are public servants? Yes
Should the CDC paper captioned above be RETRACTED because of its many flaws and false assertions? Yes
Should the Director of the CDC issue a Written Statement of apology to Advanced Labs? Yes
Should the CDC issue a National Press release to apologize for publishing a false and unscientific document? Yes
Under the Freedom of Information Act is the public permitted to view the basis for the statement in the CDC
manuscript page 2 line 64 which states..." the Centers for Disease Control and Prevention has received numerous
inquiries from National and State Health departments and clinicians about the performance of this culture method since Advanced Laboratories began offering it in 2012>,," Freedom of Information Act States "Yes"
Did Advanced Laboratories Fully Disclose ALL DETAILS of their method for Borrelia culture from human blood
in the Materials and Methods ?? Yes and in great detail.
Reference { pp 363 to 373 International Journal of Medical Science :2013: 10:362-376- covering TEN single spaced DATA loaded manuscript pages of
all aspects of media preparation, quality controls, and detailed EXACT instructions for the handling of cultures
from blood commencing with the patient pre-analytics through the Incubation conditions and quality controls, to the use of Antibody assisted identification of each positive culture, to the divers borrelia morphologies of the patient isolates, to the PCR Reaction conditions to DNA Sequence analysis for each and every positive culture, to
formal acceptance of Each patient isolate described in their manuscript to the National Center for Biotechnology
Information [NCBI] and the GenBank ACCEPTANCE of each of the Advanced laboratories deposit as
scientifically justified by GenBank oversight.
Did Advanced laboratories fulfill its scientific obligations, and regulatory oversight
demands in great detail, freely, openly, and conscientiously, with no details overlooked??? Yes

Where is the Greater Science in this unprovoked vitriolic attack by employees of the Centers for Disease Control
on a scientifically conscientious and carefully managed patient diagnostic service, fully Licensed by the
State of Pennsylvania?? Verdict for the Advanced laboratories.
{ Centers for Disease Control claims are Rejected.}

Respectfully submitted,
Alan B.MacDonald , MD, FCAP, FASCP

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
OK, "1hctom", that's enough now.
You've had your fun.
Tell them who you really are, Ed. Tell them the truth.
If you had the slightest leg to stand on you would not come here, pretending to be a patient, and playing your silly games, the same games you have been playing for maybe 20 years now, or at least as long as the Web has existed.

Tell them who you really are, you snivelling coward.

Tell them what you did in the 1990s all those years at NIH.

tell them how hard you worked to funnel all the Lyme grant money to Denialists ONLY.

Tell them all the rest, too.

How many pseudonyms have you invented to play these games, to come here and laugh at and taunt your victims, Ed? "hv808ct", "chuch padams" "nnecker" and a million others...

How many victims are you PERSONALLY responsible for? Tens of thousands? Hundreds of thousands?

Millions?

Tell them who you really are, you monster.
Elena

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Oh yes Ed, try and fool the Americans into thinking the C6 Elisa is something other than the pile of trash it has always been.

"lhctom" says:"The C6 peptide is a good test and is being considered as a CDC 2T replacement. Its used in Canada. I had the C6 peptide ELISA 3 times at 3 labs and it was positive. "

Dr Burrascano says:

"Low Sensitivity-
Elisa: Sensitivities range from 29% to 68% Stricker, BMJ 2007; 335 (7628):1008

C6 Elisa - as bad as the standard Elisa”

Source: Slides from Ilads presentation
http://www.ilads.org/media/boston/slides/burrascano-sh/burrascano-sh.html

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
The C6 Elisa only detected 5 out of 57 PCR and Igenex western blot positive patients.

(paraphrased; source is recent ILADS presentation by Dr Nick Harris, director of Igenex)

-----------
The C6 elisa has been in use in Europe for years. It was first launched by Allen Steere. It has been used in Britain for years and in fact Immunetics C6 Elisa is exactly the brand that is in use here now at Porton Down.

Here in Britain we probably have the LOWEST detection rate of Lyme in all of Europe.

Our neighbour, Holland, just across the water, has a reported rate of 100 new cases per year per 100 000 inhabitants. That figure is based on EM rashes ONLY, so is a massive underestimate of course. For as most of you know, many many people never notice a rash, and 90% of the EM rashes do not appear like the "typical" Bullseye, so will not be recognised by doctors in the first place.

So I absolutely concede that the Dutch figure is a gross understatement of the true incidence, and I don't wish in any way to play down the suffering of Dutch Lyme victims, who are also denied adequate treatment thanks to the adoption of IDSA-style criteria in Europe.

But I just want to point out that while the Dutch have an official incidence rate of 100 per 100 000, ours is 1.7 per 100 000.

I repeat, 1.7 per 100 000.

There are NO significant differences between the Lyme-related ecologies of our two countries.

We both have the same ticks, the same mice, the same birds, the same sheep, the same deer, etc etc etc.

We have the Immunetics C6 Elisa, and our OFFICIAL incidence is less than 2 per 100 000 inhabitants!

-------------

But NIH loves the C6 elisa, and CDC:

"http://www.niaid.nih.gov/topics/lymedisease/research/pages/diagnostics.aspx

"NIAID-supported investigators are now working closely with CDC to determine if the C6 ELISA can eventually replace the two-step standard ELISA and Western blot tests (Clin Immunol 132(3): 393, 2009)."

And our guest is the Monster from the NIH who, I see, has been using this particular false name for nearly a year to pretend to be one of us, and to surreptitiously push the C6 elisa. He has also impersonated REAL Lyme patients for the same purpose, I see.

It is not the Moderators we need to call on to deal with the Monster from NIH. It is the international human rights organisations we need to call on!!!

He and his colleagues need to be tried for crimes against humanity.


Elena

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
I would feel more confident this was a real patient, instead of a troll, if there had been other posts which gave us a clearer picture, instead of something that just appears out of nowhere to discredit this newer lab test. Which is behavior that trolls use.

So, not saying this is a troll, but have question marks here.

The thing is that there was an earlier culture test that was published on, and immediately trashed by the powers that be. It is a pattern to do this with any test, including PCR, that might actually be better than the two tier process endorsed/enforced by the CDC, which is not very good at all.

So, when the people who push bad tests on us then criticize other tests, we have to be suspicious of their motives.

I am not able to comprehend the science behind these allegations, so cannot say anything useful on lab contamination.

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
I see. Well, the way it looks to me is that the CDC has no credibility on lyme disease. They have done everything possible to ensure more people do not get diagnosed, and then, not get treated adequately. So, in my book, they are liars from the get go. So, with that kind of record, am I going to believe they have this one right? No.

It is going to take more than this to be convincing, a lot more.

If these other places are checking this procedure and if they are competent and qualified, then their results will be useful. If they are somehow beholden to govt for funding (and most big universities are), then maybe the results might reflect it.

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
Shadrach
Junior Member
Member # 39714

Icon 1 posted      Profile for Shadrach   Author's Homepage     Send New Private Message       Edit/Delete Post 
Rebuttal statement
RE: CDC manuscript: J.Cln.Micro. :2013 Aug14 epub ahead of print :doi: 10.1128/JCM.01674-13

To The Editor:

The above captioned paper Must be Retracted for the J.ClinMicrobiology.
The rationale for a demand for Retraction are:
A crucial ERROR in the CDC paper criticizing Advanced Labs and Dr Eva Sapi
was the CDC assumption that the BSK media testing which used LIVE control strains
of Borrelia burgdorferi, B. Garinii, and B. Afzelii
was done in Philadelphia, Penn- --- the location of Advanced Laboratories.
Actually the TRUTH is:
Dr. Eva Sapi did ALL of the BSK Media Testing of ATCC control living borrelia strains
in her West Haven Connecticut Laboratory at the University of New Haven.

Therefore: In Philadelphia, Penn at the Advanced Laboratories
There were NO LIVE BORRELIA CONTROL CULTURES
EVER!!
Geographic separation of Advanced Laboratories from the University of New Haven Laboratories
makes the CDC contamination argument an IMPOSSIBLE EVENT.

The Advanced Laboratory received tubes of human blood for Testing.
The Only living borrelia in the Advanced Laboratories building
were PRIMARY [New} { Unique} isolations of Borrelia from Human blood.

It is IMPOSSIBLE TO CONTAMINATE human blood specimens with
CONTROL STRAINS (3) of BORRELIA SPIROCHETES
if the location of the Control borrelia {allegedly the source of positive
cultures held in Philadelphia by Advanced Labs]
i was Only ON SITE in the University of New Haven Research Lab of Dr Eva Sapi.
hundreds of miles from Philadelphia, Pennsylvania.

A second error perpetrated by the CDC manuscript is as follows:
The CDC authors testify that they "developed" their own pyrG sequences
and that same sequences were deposited in the National GenBank
for all to examine.
There is NO RECORD that the CDC ever deposited pyrG sequences
in the national GenBank at the time of the publication of their paper.
Without the availability of the MISSING CDC pyrG sequences,
There was NO POSSIBLE WAY for Impartial Expert Reviewers at the
Journal of Clinical Microbiology to perform a REVIEW
and then the vote to either Approve for Publication OR
vote to REJECT for publication
The CDC submitted paper

Respectfully submitted,
Alan B. MacDonald, MD, FCAP FASCP
August 24, 2013

Posts: 4 | From Naples,Florida USA | Registered: Dec 2012  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
lhctom: could you copy and post your sequencing results? i never did that part of the test and have been curious about what the results would look like. thanks.

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Good afternoon SusanK

I am surprised you continue to treat "LHCTom" aka Ed as if he is genuine Lyme patient, and not the Monster from NIH playing his usual game of infiltrating Lyme patients' forums, pretending to be a Lyme patient.

After all, someone has just kindly posted for us a rebuttal from Dr Alan Macdonald, sent to the journal in which the lying CDC allegations were published, which proves conclusively that "LHCTom"'s comments on contamination are nonsense.

Dr Alan Macdonald, as you would know unless you are very new to Lyme, is the world's greatest Lyme scientist.

I accept that some people may be fooled by Ed aka LHCTom's little act. It can at times look a bit realistic. After all, if any one of us were to do something for twenty years non-stop, we would become good at it too.

But if all of you watch very closely, and pay attention to exactly what he says, you will eventually realise what he is.

Elena

quote:
Originally posted by susank:
lhctom: could you copy and post your sequencing results? i never did that part of the test and have been curious about what the results would look like. thanks.



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
SusanK, I forgot to mention, I had not met you before, but a quick glance into the archive reveals that you are a very original thinker. I see, for example, that you believe that antibiotics might be causing false positive results on Lyme western blots.

That is very original. In fact, I have never heard of that before! Not even from the Denialists, whose agenda, of course, it would serve perfectly.

Would you mind explaining to me, scientifically, how it would be possible for antibiotics to cause positive results on a Lyme western blot? I cannot for the life of me understand it.

Thanks.
Elena

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Monster (LHCTom/Ed),

Stop misrepresenting me. I clearly stated that my info was from as ILADS presentation by Dr Nick Harris, not from any other site.

Anyway, let's look at the quote YOU yourself have posted. It includes this information:

"In a set of 30 patients with late Lyme disease, all having CDC-positive IgG and IgM Western Blots, the C6 ELISA was positive in ONLY 10% OF THE PATIENTS. It is NOT A GOOD TEST FOR LATE-STAGE Lyme disease."

(my capitalisation)

Look at your membership number, Mr "LHCTom" aka Monster from the NIH. It is Number 41,709. Now, as you have just joined Lyme Net the other day, we know that it is a very recent number. In other words, this group has over 40 000 members.

Do you not comprehend that the VAST MAJORITY of those 40 000 plus people are here because of the issue of "late-stage" (or rather, CHRONIC) Lyme?

And this is just ONE, mostly US-based, group. Do you have any idea how many people are out there in the world, who have had to join groups like this one, because their CHRONIC Lyme is not recognised?

Do you think there was a Worldwide Lyme Protest, for the first time ever, because of something other than CHRONIC Lyme being ignored?

And then you recommend to us a test which you imply Igenex are RECOMMENDING, which is only TEN PERCENT SENSITIVE for chronic Lyme?

Are you out of your tiny mind?

Igenex offered the test not long after it first came out, in 2003. I believe the study they refer to, which was 73% positive in finding VERY EARLY Lyme cases which were also CDC blot-positive, is from 2003.

Actually, as YOU KNOW WELL as you are a scientist yourself, 73% sensitivity is a pretty lousy figure.

My reference from Dr Harris is a lot more recent than yours.

The Americans are unfamiliar with the C6 Elisa, as I gather it's not widely in use in USA. And you are trying to con them into thinking that it's a good and sensitive test.

If you have chronic Lyme, it might just pick it up. But it is FAR MORE LIKELY not to, and then you will have an official, FDA-endorsed BIG FAT NEGATIVE on your medical notes that will just prejudice doctors even more against you.

ALL Antibody tests are useless in Lyme, because of the myriad ways in which Lyme dysregulates and suppresses parts of the immune system.

We need antigen-based tests, and GOLD standard tests like blood culture for chronic Lyme, such as Dr Sapi and her colleagues worked hard to produce, and the Monster and CDC are working hard right now, to discredit.

Elena

quote:
Originally posted by lhctom:
Below is the actual quote by Nick Harris from IGenex.

Lisa aka Elena, would have you believe the test is 10% sensitive. But she is conveniently leaving off most of what Nick Harris actually said. The test has been shown to be 75-90% (other studies have shown 96%) except late stage infections where a small study at IGenex showed only 10%. Since this is the only other test offered in the US that is recognized by ID doctors, if you want to get a diagnosis that is believed, the C6 is one way to try. Its very dishonest to partially quote someone or a study just to give the impression you want. We all know this is exactly what the IDSA does. So isn't this the same? Lisa, Elena or whoever she is is giving out information intentionally altered from a direct quote. This is exactly the anti-science behavior that has led to all the problems. We need honest activists if we want the truth to emerge. I said the C6 has problems but we are very limited to accepted and validated tests here in the US. Igenex offers the test. I have late stage Lyme and I was positive at IGenex and tony Brook on the C6. It helped me. Why would IGenex offer the test if Nick Harris did not see some value?

Direct quote Nick Harris

http://www.ldsg.org/index.php?id=11&no_cache=1&tx_ttnews[tt_news]=57&tx_ttnews[backPid]=4&cHash=ab5f39f8e9

3) The ELISA test and C6 ELISA test:

The ELISA test works quite well for patients with EM rash and a known tick bite, within 3-4 months of the tick bite. After 3-4 months, the test loses sensitivity. The C6 peptide ELISA detects the C6 found within the antibody formed against borrelia, so this is an antibody test. In a study with patients with CDC-positive IgG and IgM Western blot tests, the C6 ELISA was positive in 73% of these patients. In a set of 30 patients with late Lyme disease, all having CDC-positive IgG and IgM Western Blots, the C6 ELISA was positive in only 10% of the patients. It is not a good test for late-stage Lyme disease. Other studies have been done with various results, all with 100% of patients CDC-positive by Western Blot. The best result for the C6 ELISA was just under 90% - results varied widely from study to study.



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
Did Susan really say abx could cause a false positive WB? The FDA said the opposite....that abx could abrogate the antibody response.

But maybe what Susan is trying to do is discredit a positive test after an abx challenge. Hmmm, does sound like a troll, or a seriously confused patient.

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
Shadrach
Junior Member
Member # 39714

Icon 1 posted      Profile for Shadrach   Author's Homepage     Send New Private Message       Edit/Delete Post 
Dear Ed,
Have You ever used CLUSTAL X?

Try It.
You will find detail that is present in BLASTn
but easier on the Eye.

22% of Sapi's Garinii-like isolates had either one
or two base substitutions with
reference strain AB55778.1 haplotype (n==603)
Garinii.
With Barcelona haplotypes (n=603)in GenBank
Jf331248.1 Jf331231.1, and
Jf331265.1 Japanese haplotype
the identity among this reference group of 4 was 100 each with each other. Net take home message:
all bona fide Garinii haplotypes, but difference by 166 base mismatches with the Sapi GenBank Deposits.
Have you ever successfully made a GenBank deposit
which passed muster and was published by Genbank?
I would venture a guess that you have not.

So make the move over to Clustal analysis for DNA sequence alignments. It works!
By the way in B31 the complete pyrG sequence is 1602 bases,-- Soooo with 603 bases to examine we are only seeing a part of th total pyrG ORF
Alan MacDonald MD , FCAP FASCP
Aug 25 2013
PS:It is now Aug 25 2013 at 14:38 hours.
Do you know where your CDC deposits Kf170280
KF170281 , KF170282 are??
They are not presently available to the Public.
Perhaps missing in action/
Perhaps prisoners in a CDC Remote site with Cheney.
Perhaps they will never see the clear light of day.

With No CDC GeneBank Deposits available to the public,
How is it that the Outside expert reviewers
were able to complete their review of the CDC paper [ without the missing 3 DNA CDC reference pyrG sequences? ]
Did the paper bypass Outside Impartial review? Who paid between $2000 to $3000 for the CDC paper to have accelerated paper-less publication { epub ahead of print}??
Were taxpayer funds used to advance a CDC false scenario?
Alan b. MacDonald MD

Posts: 4 | From Naples,Florida USA | Registered: Dec 2012  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
Sounds pretty convincing to me. Thanks for the explanation.

If the labs involved in this were separated geographically by nearly 200 miles, then it seems to me that gene sequencing is not even needed to show that the CDC totally blew this, and defamed the lab. If I had a lot of money, I would finance a libel case against Dr. Johnson and her buddies. When are we going to see some CDC heads roll for this kind of malfeasance?

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
And does anyone think there is impartial review of lyme articles at this IDSA journal?

No.

They will print any pack of lies anyone cares to send them so long as it prevents diagnosing and treating lyme.

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
Hold your horses. Somebody must be misreading something I wrote. Re: antibiotics and testing.

I did challenges to provoke a response.

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
Or a misquoted patient. Sorry about that, Susan.
Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
If someone will show me a post where I wrote against Abx and testing I will correct it.

I should have never entered into this discussion.

Will "tom" share his results - ie actual copies?

Would be interesting if he would.

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
If you think the culture has problems based on contamination that did not actually exist because the two labs were several hundred miles apart, then you are not thinking very well, if not actually a troll. On that issue, it is unclear. So before you accuse people here of being a cult, maybe you should review the evidence.

And I am questioning your credentials to say these sequences are impossible, when the missing CDC samples are not to be found, and are irrelevant if the contamination could not have occurred.

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
I think you are right, and since you are quacking, you are a duck (troll). Didn't want to rush to judgement, but pretty clear now.

And addressing my next comment to someone who is not a troll and does understand these genetic issues, unlike myself.

Why would the exact same sequences found in multiple spirochetes of the same species be thought to be evidence of contamination anyway? Would you not expect a recently introduced pathogen from a place of more genetic variability to be less variable? In other words, if this is a European species brought here by a bird in recent years, then it would have more genetic variability at its origin (Europe) than at a new location where it was recently established (the U.S.).

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
Poppy - its all over my head but was having the same thoughts.

I have not studied Bgar - but the bit I did read about - seems Bgar found in colder climates.
Saw a ref to Alaska?

Dunno - does Igenex test for Bgar?

Wonder why ALS would? Of course people travel to other countries and could be exposed. And folks move here from the endemic countries.

It gave me a bit of a scare in regards to popssible problems with the ALS culture - else I would not be in on this discussion.

I feel confident my Bb pos. test from ALS was not compromised.

Its just all weird about the Bgar and Baf.

To add - re: Elena?s questions to me:

I "believe Abx cause false positive WB's"????
then
I "believe Abx cause positive WB's" ???

I thought I might have still a few marbles left in my head - Abx are taken pre-test to "help" get the pathogens out/into the blood - to be detected on a WB? Right?

No one wants a positive test. But if you are Bb positive you sure want one. Instead of wandering in the wilderness wondering what the "h" is wrong with you.

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
Carol in PA
Frequent Contributor (5K+ posts)
Member # 5338

Icon 1 posted      Profile for Carol in PA     Send New Private Message       Edit/Delete Post 
Who is lhctom and why are all his posts deleted?

His profile says ten posts, but none are there.

Posts: 6947 | From Lancaster, PA | Registered: Feb 2004  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
I guess we won't be seeing his actual Bgar test results. Hmmmmmmmmmm

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
People who read this thread are going to be confused, because some posts won't make any sense with the troll's deleted. But, goodbye, don't come back and mess with sick people.

No, don't think we will be seeing his test results, probably because they don't exist.

Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
"Tom" - I have been giving you the benefit of the doubt - a wee bit - that you are a "good guy" but that is looking very doubtful.

But you did write something that piqued my interest. I guess its old news - but it did give me some thoughts in regards to Bb strains B31 and 297.

It is a fact that Labcorp uses only B31 in their tests?

I have lost count of how many times I have been tested by Labcorp for Lyme - starting in 1996.

Every band - every single time was negative.

Just last month on my Labcorp orders I ended up somehow being tested again. Not one band showed positive. Not even 41. (Arup lab at least picked that one up years ago).

ALS - pretty much supported by Igenex - shows I have Lyme. Could I deduce that I don't have strain B31 - only 297? And would that be of any significance? Different treatment?
Where geographically is 297 most likely to be found? Anyone?

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
beaches
Frequent Contributor (1K+ posts)
Member # 38251

Icon 1 posted      Profile for beaches     Send New Private Message       Edit/Delete Post 
I'm a bit late to post here on this thread.

But I did get a chance to read what lhctom/Ed had to say.

I'm no scientist, but even I, ignorant layperson that I am, was able to follow the logic.

I did notice that lhctom/Ed got a bit agitated when confronted with the science and began to spew all sorts of accusations/generalizations against the membership here...

Posts: 1885 | From here | Registered: Jul 2012  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Friends, let's welcome the legendary Dr Alan Macdonald to LymeNet.

Thank you so much for coming here, Dr Macdonald. I did see your earlier post, but I thought it was just a patient posting a text you had written.

Thank you for debunking the evil Ed (aka "LHCTom" aka "Thomas Eames" etc), who is a notorious Denialist scientist whose real name shall be revealed very shortly.

And thank you so much for all the incredible work you have done for us, all these years, which one day, when the cover-up is over, and its perpetrators all exposed, will be rewarded with a Nobel Prize.

Elena Cook


quote:
Originally posted by Shadrach:
Dear Ed,
Have You ever used CLUSTAL X?

Try It.
You will find detail that is present in BLASTn
but easier on the Eye.

22% of Sapi's Garinii-like isolates had either one
or two base substitutions with
reference strain AB55778.1 haplotype (n==603)
Garinii.
With Barcelona haplotypes (n=603)in GenBank
Jf331248.1 Jf331231.1, and
Jf331265.1 Japanese haplotype
the identity among this reference group of 4 was 100 each with each other. Net take home message:
all bona fide Garinii haplotypes, but difference by 166 base mismatches with the Sapi GenBank Deposits.
Have you ever successfully made a GenBank deposit
which passed muster and was published by Genbank?
I would venture a guess that you have not.

So make the move over to Clustal analysis for DNA sequence alignments. It works!
By the way in B31 the complete pyrG sequence is 1602 bases,-- Soooo with 603 bases to examine we are only seeing a part of th total pyrG ORF
Alan MacDonald MD , FCAP FASCP
Aug 25 2013
PS:It is now Aug 25 2013 at 14:38 hours.
Do you know where your CDC deposits Kf170280
KF170281 , KF170282 are??
They are not presently available to the Public.
Perhaps missing in action/
Perhaps prisoners in a CDC Remote site with Cheney.
Perhaps they will never see the clear light of day.

With No CDC GeneBank Deposits available to the public,
How is it that the Outside expert reviewers
were able to complete their review of the CDC paper [ without the missing 3 DNA CDC reference pyrG sequences? ]
Did the paper bypass Outside Impartial review? Who paid between $2000 to $3000 for the CDC paper to have accelerated paper-less publication { epub ahead of print}??
Were taxpayer funds used to advance a CDC false scenario?
Alan b. MacDonald MD



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Susank, I was not making any accusations against you.

I said you were an original thinker, because you seemed to think antibiotics could cause FALSE positive Lyme tests.

Perhaps I should have written "False" twice, instead of once, to be clearer.

My apologies.

Both sides of the Lyme War accept that at times the antibody response can be abrogated by antibiotics.

Some on our side believe that after treatment, at times, antibodies not seen before on western blot may appear.

No one, to my knowledge, has ever suggested that antibiotics can cause FALSE positive blots.

That's why I asked you how it could happen? After all, that could only be the case, if a molecule of antibiotic, which is nearly always a synthetic chemical compound, had almost the identical chemical composition to an epitope, ie part of a protein on the surface of a living Lyme bacteria, which can elicit an immune response.

I had glanced randomly into the archive and found a thread (see below) from 2011 in which you wrote this:

"Is what kind of makes me wonder if Abx could cause false pos LD tests."

That's all.

http://flash.lymenet.org/scripts/ultimatebb.cgi/topic/1/108754?

susank
LymeNet Contributor
Member # 22150

Icon 1 posted 27 June, 2011 05:41 PM Profile for susank Send New Private Message Edit/Delete Post Reply With Quote Razzle - yes have read that. Is what kind of makes me wonder if Abx could cause false pos LD tests. I cannot connect the dots how that could happen. and with non tetracycline drugs.
I have so many bands but not positives on the "specific" bands - only IND's. During a phone conversation in general discussing my results - was told that I need to look elsewhere since I did not seroconvert on the "specific" "hot" bands after Abx challenges. I did actually "convert" a bit - but to what? Has to be something antibiotic sensitive?"

It's no big deal, Susan. but I am curious as to why you still think that "Tom" ("LHCTom" aka "Thomas Eames") who is really named Ed, has anything of value to tell us. when you have just seen the greatest Lyme scientist in the world treat him as if he is a fraud. Which of course he is.

Do you think a scientist of the stature of Dr Macdonald would risk his reputation by making accusations against someone who claimed to be a "suffering patient", if there was the slightest doubt in his mind as to what that man really was ?

Elena

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
So it seems that "LHCTom"/"Thomas Eames" aka Ed has disappeared, and so have all of his messages.

One of two things has happened.

1. After being exposed and dealt a stunning blow by Dr Alan Macdonald, the Monster from NIH has turned tail and fled, like the coward he is.

or

2. Our good moderators, seeking to protect us from frauds and con merchants, have realised that he is back here for the nth time, pretending,yet again, to be a patient.

And though Ed still has a position at NIH, and still retains respectability as a member of various prestigious scientific societies like the American Association for the Advancement of Science (A.A.A.S.). our good moderators have understood what a hateful fraud he is, and slung him out right on his A.A.A.S..

Regardless of which has happened, I would like to make an URGENT request, not only of the moderators, but of every person here, whether you have participated in this thread, or merely read it:

Please SAVE any files you may have showing what he said on this forum.

Please SAVE them both in electronic form, and in HARD COPY.

Moderators, please RETAIN any technical, server-based or other data in any form that you may have, that might allow the origins of his messages to be traced.

Please everyone SAVE this material, and STORE it SAFELY. Because one day it could form part of a huge dossier of important evidence of the FRAUD perpetrated by US government scientists, and their colleagues in other countries such as mine, fraud that has resulted in the suffering of MILLIONS of people.

I know I joke a lot and use a lot of sarcasm. But I am deadly SERIOUS about this point. Things will never improve until all these morally-challenged Denialists are EXPOSED.

Elena Cook

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Dear Susan

I don't think it's so weird that Borrelia garinii was among the varieties found in the blood of US patients.

Dr Macdonald has kindly posted on Youtube a very informative set of video; the latest one, just out, is here:


https://www.youtube.com/watch?v=2RATCS-3v9Q

If you watch the videos, you will learn that B. garinii is in Mexico and south america - these are not cold countries.

It is all over Europe -hot and cold. Dr Macdonald posted info about 4 identical garinii pyrG sequences from four distinct strains of garinii in Spain. (Clearly Genbank didnt consider them "contamination" just becuase they had the identical portion of pyrG gene.)

Spain is very hot - English people flock their every summer for that reason.

Now, remember that Mexico is connected to the US by LAND, so we dont even need to look at seabirds.

It's very unlikely that Mexican borrelia garinii are stopped at the border and asked to produce their documents before they can proceed any further.
Elena


quote:
Originally posted by susank:
Poppy - its all over my head but was having the same thoughts.

I have not studied Bgar - but the bit I did read about - seems Bgar found in colder climates.
Saw a ref to Alaska?

Dunno - does Igenex test for Bgar?

Wonder why ALS would? Of course people travel to other countries and could be exposed. And folks move here from the endemic countries.

It gave me a bit of a scare in regards to popssible problems with the ALS culture - else I would not be in on this discussion.

I feel confident my Bb pos. test from ALS was not compromised.

Its just all weird about the Bgar and Baf.

To add - re: Elena?s questions to me:

I "believe Abx cause false positive WB's"????
then
I "believe Abx cause positive WB's" ???

I thought I might have still a few marbles left in my head - Abx are taken pre-test to "help" get the pathogens out/into the blood - to be detected on a WB? Right?

No one wants a positive test. But if you are Bb positive you sure want one. Instead of wandering in the wilderness wondering what the "h" is wrong with you.



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
lhctom
Member
Member # 41709

Icon 1 posted      Profile for lhctom     Send New Private Message       Edit/Delete Post 
One of two things has happened.

1. After being exposed and dealt a stunning blow by Dr Alan Macdonald, the Monster from NIH has turned tail and fled, like the coward he is.

or

2. Our good moderators, seeking to protect us from frauds and con merchants, have realised that he is back here for the nth time, pretending,yet again, to be a patient.

And though Ed still has a position at NIH, and still retains respectability as a member of various prestigious scientific societies like the American Association for the Advancement of Science (A.A.A.S.). our good moderators have understood what a hateful fraud he is, and slung him out right on his A.A.A.S..

Regardless of which has happened, I would like to make an URGENT request, not only of the moderators, but of every person here, whether you have participated in this thread, or merely read it:

Please SAVE any files you may have showing what he said on this forum.

Please SAVE them both in electronic form, and in HARD COPY.

Moderators, please RETAIN any technical, server-based or other data in any form that you may have, that might allow the origins of his messages to be traced.

Please everyone SAVE this material, and STORE it SAFELY. Because one day it could form part of a huge dossier of important evidence of the FRAUD perpetrated by US government scientists, and their colleagues in other countries such as mine, fraud that has resulted in the suffering of MILLIONS of people.

I know I joke a lot and use a lot of sarcasm. But I am deadly SERIOUS about this point. Things will never improve until all these morally-challenged Denialists are EXPOSED.

Elena Cook

Paranoia is a delusional disorder characterized by the dominance of one delusion or false belief without any other sign of mental illness. The person’s behavior depends on which delusion they have. For example, a person who has a delusion of persecution believes that other people are spying on them or plotting to harm them in some way. Online bullying and manipulation of others can be a result of a delusional paranoid disorder – for example, the person believes they are being stalked online as part of a conspiracy and accuse anyone with a different opinion as being the “stalker” and an agent of the conspiracy. Fears are described as paranoid when they are rigid and exaggerated and not based in fact. They are unable to consider opinions divergent from their own. It becomes a progressive personality disorder of delusions of persecution with extreme grandeur and is strenuously defended with convoluted logic and reason. It includes systematized delusions ascribing hostile intentions to others often driven by a sense of a mission. They are easily offended, readily assign harmful meanings to other people’s views and quickly become hostile, aggressive and argumentative. They often collect weaker personalities around them forming a dangerous cult that further drives their delusions.

best regards,

Your friend Ed

Posts: 15 | From CA | Registered: Aug 2013  |  IP: Logged | Report this post to a Moderator
susank
Frequent Contributor (1K+ posts)
Member # 22150

Icon 1 posted      Profile for susank     Send New Private Message       Edit/Delete Post 
Elena - I see what you mean. I should have written false positive bands i/o false positive tests.

That was written pre ALS test - when I was still wandering in the wilderness.

WB challenges for Igenex. Taking ABX and on IVIG (IVIG has BTW some Bb antibodies in it).

So I had positive bands but every Igenex test was considered negative. I talked to Mr Harris - I had questions about bands 30 and 31 - epitopes etc.
During that discussion I know I asked something along the lines of how I could have so many positive bands - after challenges - and be Lyme negative. He strongly suggested I look elsewhere for a Dx.

Can you understand the frustration? If those bands not Lyme - then what was causing them to appear? I studied everything I could find on the individual bands. Noting that some other pathogens were associated with some bands.
I think Chlamydia Pn was one of them.

Suffice to say that I wish the ALS test had been available years before I was able to get it done.
Would have saved me and others much angst.

Were it not for the ALS test I would still be wondering what all I have that is not Lyme.

--------------------
Pos.Bb culture 2012
Labcorp - no bands ever
Igenex - Neg. 4 times
With overall bands:
IGM 18,28,41,66 IND: 23-25,34,39
IGG 41,58 IND: 39
Bart H IGG 40

Posts: 1613 | From Texas | Registered: Aug 2009  |  IP: Logged | Report this post to a Moderator
Shadrach
Junior Member
Member # 39714

Icon 1 posted      Profile for Shadrach   Author's Homepage     Send New Private Message       Edit/Delete Post 
Call for CDC Freedom of Information Release of
Documents relevant to the Johhnson et al
CDC official critique of Advanced Labs Blood human blood culture patient results:
________________________________________________
Dear Dr. MacDonald,
                All FOIA requests must be submitted formally to the CDC FOIA office. More information can be obtained at the following website: http://www.cdc.gov/od/foia/
 
 
Sincerely,
 
 
 
***************************************************
C. Ben Beard, Ph.D.
Chief, Bacterial Diseases Branch
Division of Vector-Borne Diseases
CDC
Mail Stop P-02
3156 Rampart Road
Fort Collins, CO 80521 USA

 
From: alan macdonald [mailto:[email protected]]
Sent: Monday, August 26, 2013 5:05 PM
To: Beard, Charles B. (CDC/OID/NCEZID)
Subject: Request for documents under the freedom of information act
 
Dear Dr. Beard,
 
As the official CDC spokesperson for all communications relating to Lyme borReliosis
from US Citizens:
 
I respectfully request that you provIDE me with any and all
communications which were received by the CDC from :
 
1.State Public Health Officials
2. PHYSICIANS
3. Scientists with US Governmental funding for Lyme Borreliosis Research
4. Federal Employees
5. Members of the U.s. Congress and the U.S. Senate
 
In connection with allegations that  flawed Medical  Diagnostic
services were rendered to the public by
Advanced Laboratories, a fully licensed and fully compliant 
medical  diagnostic facility under the Statues of Pennsylvania.
 
Under the Freedom Of Information Act, I am requesting documentation
for the allegations of .....Bad Laboratory Medical diagnostic Practices .....(SIC) 
by  Advanced  Diagnostic Laboratories, as is presentED in the
CDC Sanctioned publication in Journal of Clinical Microbiology
2013, "Assessment of New Culture Method to Detect Borrelia species
in Serum of Lyme Disease Patients", 2013, 14 August, e Pub ahead of print
J.Clin. Microbiology, doi:10.1128/JCM.01674-13, authored by
"Barbara J. B.Johnson, Mark A. Pilgard, and Theresa M Russell"
"Division of Vector-Borne  Diseases, Centers for Disease Control and Prevention,
Ft. Collin, Co, USA"
 
Direct quotationS from the published manuscript of Johnson et al as captioned
above: {Begin Quote]
 
"    The Centers for Disease Control and Prevention has received numerous  inquiries  From
national and state health departments and clinicians about the performance of this
culture method since Advanced Laboratory Services began  offering  it in 2012
[http://www.advanced-lab.com/spirochete.php ].."   End quote] { manuscript submission line 64-67]
 
 
Further:  Johnson et. al. state in their published manuscript:
 
   [Line 151-152]   Begin quote
"The methods used by Sapi et. al. to assess test specificity were inadequate
to rule out false positivity by culture of Laboratory strains of PCR amplicons"
[Line 195-204}
 
" ...taken together ,our data and those of Sapi et.al. indicate that laboratory
contamination  was the probable source of the Borrelia DNA found in the patient 
specimens. The vast majority of patient pyrG sequences (41/51) are indistinguishable
from laboratory strains used by the investigators. the clinical relevance of the
of the pygR sequences (10/51) is unclear; these findings may also be consistent
with laboratory  contamination. Before use in Clinical medicine, novel findings must
be independently verified. Independent verification is particularly critical when
claims are at  odds  with a large body of other scientific work, and when they may trigger 
unnecessary antibiotic treatment of patients. We caution clinicians and patients to
wait for independent verification by scientifically sound methods before using this
culture service for diagnostic services"   End quote
 
The contamination scenario described by Johnson and CDC employees is IMPOSSIBLE.
because the Live Control ATCC strains used to validate the acceptability of
a modified BSK Media
were all done in the West Haven research laboratory .
Advanced Laboratories of Philadelphia and were NEvER
in psooession of live Control borrelia.
Summation:
TWO  geographially  separated Laboratories -  in a joint scientific Study -
No Cross contamination between the two laboratories.
 
This single fact Negates the Entire content of the Johnson et al CDC authored
J. Clin.  Microbiology   publication.
 
I have already notified Dr. Thomas Frieden  CDC Director of these facts.
I have received no response from Dr Frieden  as of this  date.
 
The Johnson et al publication must be officially Retracted.
It is Factually Flawed.
 
It leads the reader to believe that CDC deposits to GenBank
were  published  in advance of the J. Clin  Microbiology  article 
so that Impartial and highly vetted expert outside reviewers could analyze
.the content of DNA sequences  { generated by CDC scientists in Ft Collins, Co,}
 
[ KF 170280, KF 170281, KF 170282 ]
 with 
and use Clustal analysis and BLASTn analysis  to compare these with GenBank 
accepted and published  deposits  ofborrel Isolates from humans Subject: CDC abuse of Power - OpEdto the Washington Post
 
Summary: CDC Misuse of Power
------------------------------------------------------------------------------------------------------------------------------------
A crucial ERROR in the CDC paper doi:10.1128/JCM.01674-13 was the CDC assumption that CONTAMINATION of patient blood 
specimens for analysis resulted in false reports of the Lyme disease spirochete in 51 patients.
Dr. Eva Sapi in her Research Laboratory at the University of New Haven possessed Living reference type 
Lyme spirochetes.    In Philadelphia, Penn, at the Advanced Laboratories where all blood cultures were done, 
the CDC contamination story was Impossible, because none of the alleged contaminants existed there.
The Only living borrelia in the Advanced Laboratories building were PRIMARY [New} { Unique}   
isolations of Borrelia from Human blood.  { A major step forward in the efforts to improve Testing for Lyme Disease}
The full power of the CDC is vast.  The CDC did not Fact Check the details before releasing their paper.
 Abuse of power is clearly in play here, to the detriment of public health.
[ 149 words]
------------------------------------------------------------------------------------------------------------------------------------------
 
 
 
 
Respectfully submitted, 
Alan B. MacDonald, MD, FCAP FASCP
8427 Benelli Court
Naples, Florida, 34114
email: [email protected]
august 26 ,2013
 
Disclosure statement: I am not an employee of any governmental agency 
or of any privateLaboratory. I am fully retired after 30 years of practice
 as a hospital diagnostic pathologist. I have never received any payments 
or other compensation of any kind from the parties in this dispute.
August 24, 2013
 
 
As of17:35 hrs on August 26 2013,  GenBank has not yet published or accepted
as valid, the CDC deposits KF170280 ,KF170281 , KF170282.
 
in GenBank, National Center for Biotechnology Information,
by  Advanced Laboratories.
 
Therefore, with no  GenBank validated  CDC deposits, there is no way to
draw any scientific conclusions about the   previously GenBank accepted
 Advanced laboratories DNA sequence  deposits from Human borrelia Culture
 positive DNA sequences.
 
The CDC  position  is scientifically Untenable, in this matter/
 
If I do not hear from you promptly, I shall escalate this matterto
the the US Senate Oversight Committee for the Centers for Disease Control
for  investigation  of the possibility of Scientific Misconduct.
 
No Investigation will be forthcoming if:
1 .Johnson et all RETRACT their manuscript from the J. Clinical  Microbiology
2. The Director of the CDC issues a Press Release, with a Public apology 
    for a CDC Flawed  Science  publication in an  international
     Academic Journal { Journal of Clinical Microbiology}
 
 
Yours truly
 
Alan B. MacDonald, MD Fellow of the College of American Pathologists
 
I am sending copies under separate cover  of this letter to:
 
Sen. Kristen Gillebrand,  New York
sen. Richard Blumenthal, Connecticut

Posts: 4 | From Naples,Florida USA | Registered: Dec 2012  |  IP: Logged | Report this post to a Moderator
Shadrach
Junior Member
Member # 39714

Icon 1 posted      Profile for Shadrach   Author's Homepage     Send New Private Message       Edit/Delete Post 
The RETURN of ED
from an undisclosed Location
to this forum

On August 26 2013
after his intentional removal of all
traces of any of his previous postings
is duly noted.
He is now offering services as a Medical Doctor.

From What School of Medicine did you graduate
Ed?

Alan B. MacDonald , MD
Graduate , 1974, College of Physicians and Surgeons
Columbia University in the City of New York

Posts: 4 | From Naples,Florida USA | Registered: Dec 2012  |  IP: Logged | Report this post to a Moderator
poppy
Frequent Contributor (1K+ posts)
Member # 5355

Icon 1 posted      Profile for poppy     Send New Private Message       Edit/Delete Post 
Hey moderators, why is a troll being allowed to stay here? Please ban this guy. No patients should be exposed to continuing abusive behavior from someone who calls them cult like. Get rid of ihcTom!!!!!
Posts: 2888 | From USA | Registered: Mar 2004  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Dr. Macdonald, thank you so much for doing this.

I am expecting they will not fulfil the FOIA request, or else attempt to keep us waiting five years as they did to Kris Newby, producer of Under our Skin.

In the event they do the above, I would like to propose that every single one of us support Dr Macdonald's initiative to take the matter to the Senate Oversight Committee, including those like myself who live in other countries.

After all the Denialism in all our countries has emanated, ultimately, from the same source - the corrupt officials in the US.

And Ed is one of them.

Elena

quote:
Originally posted by Shadrach:
Call for CDC Freedom of Information Release of
Documents relevant to the Johhnson et al
CDC official critique of Advanced Labs Blood human blood culture patient results:
________________________________________________
Dear Dr. MacDonald,
                All FOIA requests must be submitted formally to the CDC FOIA office. More information can be obtained at the following website: http://www.cdc.gov/od/foia/
 
 
Sincerely,
 
 
 
***************************************************
C. Ben Beard, Ph.D.
Chief, Bacterial Diseases Branch
Division of Vector-Borne Diseases
CDC
Mail Stop P-02
3156 Rampart Road
Fort Collins, CO 80521 USA

 
From: alan macdonald [mailto:[email protected]]
Sent: Monday, August 26, 2013 5:05 PM
To: Beard, Charles B. (CDC/OID/NCEZID)
Subject: Request for documents under the freedom of information act
 
Dear Dr. Beard,
 
As the official CDC spokesperson for all communications relating to Lyme borReliosis
from US Citizens:
 
I respectfully request that you provIDE me with any and all
communications which were received by the CDC from :
 
1.State Public Health Officials
2. PHYSICIANS
3. Scientists with US Governmental funding for Lyme Borreliosis Research
4. Federal Employees
5. Members of the U.s. Congress and the U.S. Senate
 
In connection with allegations that  flawed Medical  Diagnostic
services were rendered to the public by
Advanced Laboratories, a fully licensed and fully compliant 
medical  diagnostic facility under the Statues of Pennsylvania.
 
Under the Freedom Of Information Act, I am requesting documentation
for the allegations of .....Bad Laboratory Medical diagnostic Practices .....(SIC) 
by  Advanced  Diagnostic Laboratories, as is presentED in the
CDC Sanctioned publication in Journal of Clinical Microbiology
2013, "Assessment of New Culture Method to Detect Borrelia species
in Serum of Lyme Disease Patients", 2013, 14 August, e Pub ahead of print
J.Clin. Microbiology, doi:10.1128/JCM.01674-13, authored by
"Barbara J. B.Johnson, Mark A. Pilgard, and Theresa M Russell"
"Division of Vector-Borne  Diseases, Centers for Disease Control and Prevention,
Ft. Collin, Co, USA"
 
Direct quotationS from the published manuscript of Johnson et al as captioned
above: {Begin Quote]
 
"    The Centers for Disease Control and Prevention has received numerous  inquiries  From
national and state health departments and clinicians about the performance of this
culture method since Advanced Laboratory Services began  offering  it in 2012
[http://www.advanced-lab.com/spirochete.php ].."   End quote] { manuscript submission line 64-67]
 
 
Further:  Johnson et. al. state in their published manuscript:
 
   [Line 151-152]   Begin quote
"The methods used by Sapi et. al. to assess test specificity were inadequate
to rule out false positivity by culture of Laboratory strains of PCR amplicons"
[Line 195-204}
 
" ...taken together ,our data and those of Sapi et.al. indicate that laboratory
contamination  was the probable source of the Borrelia DNA found in the patient 
specimens. The vast majority of patient pyrG sequences (41/51) are indistinguishable
from laboratory strains used by the investigators. the clinical relevance of the
of the pygR sequences (10/51) is unclear; these findings may also be consistent
with laboratory  contamination. Before use in Clinical medicine, novel findings must
be independently verified. Independent verification is particularly critical when
claims are at  odds  with a large body of other scientific work, and when they may trigger 
unnecessary antibiotic treatment of patients. We caution clinicians and patients to
wait for independent verification by scientifically sound methods before using this
culture service for diagnostic services"   End quote
 
The contamination scenario described by Johnson and CDC employees is IMPOSSIBLE.
because the Live Control ATCC strains used to validate the acceptability of
a modified BSK Media
were all done in the West Haven research laboratory .
Advanced Laboratories of Philadelphia and were NEvER
in psooession of live Control borrelia.
Summation:
TWO  geographially  separated Laboratories -  in a joint scientific Study -
No Cross contamination between the two laboratories.
 
This single fact Negates the Entire content of the Johnson et al CDC authored
J. Clin.  Microbiology   publication.
 
I have already notified Dr. Thomas Frieden  CDC Director of these facts.
I have received no response from Dr Frieden  as of this  date.
 
The Johnson et al publication must be officially Retracted.
It is Factually Flawed.
 
It leads the reader to believe that CDC deposits to GenBank
were  published  in advance of the J. Clin  Microbiology  article 
so that Impartial and highly vetted expert outside reviewers could analyze
.the content of DNA sequences  { generated by CDC scientists in Ft Collins, Co,}
 
[ KF 170280, KF 170281, KF 170282 ]
 with 
and use Clustal analysis and BLASTn analysis  to compare these with GenBank 
accepted and published  deposits  ofborrel Isolates from humans Subject: CDC abuse of Power - OpEdto the Washington Post
 
Summary: CDC Misuse of Power
------------------------------------------------------------------------------------------------------------------------------------
A crucial ERROR in the CDC paper doi:10.1128/JCM.01674-13 was the CDC assumption that CONTAMINATION of patient blood 
specimens for analysis resulted in false reports of the Lyme disease spirochete in 51 patients.
Dr. Eva Sapi in her Research Laboratory at the University of New Haven possessed Living reference type 
Lyme spirochetes.    In Philadelphia, Penn, at the Advanced Laboratories where all blood cultures were done, 
the CDC contamination story was Impossible, because none of the alleged contaminants existed there.
The Only living borrelia in the Advanced Laboratories building were PRIMARY [New} { Unique}   
isolations of Borrelia from Human blood.  { A major step forward in the efforts to improve Testing for Lyme Disease}
The full power of the CDC is vast.  The CDC did not Fact Check the details before releasing their paper.
 Abuse of power is clearly in play here, to the detriment of public health.
[ 149 words]
------------------------------------------------------------------------------------------------------------------------------------------
 
 
 
 
Respectfully submitted, 
Alan B. MacDonald, MD, FCAP FASCP
8427 Benelli Court
Naples, Florida, 34114
email: [email protected]
august 26 ,2013
 
Disclosure statement: I am not an employee of any governmental agency 
or of any privateLaboratory. I am fully retired after 30 years of practice
 as a hospital diagnostic pathologist. I have never received any payments 
or other compensation of any kind from the parties in this dispute.
August 24, 2013
 
 
As of17:35 hrs on August 26 2013,  GenBank has not yet published or accepted
as valid, the CDC deposits KF170280 ,KF170281 , KF170282.
 
in GenBank, National Center for Biotechnology Information,
by  Advanced Laboratories.
 
Therefore, with no  GenBank validated  CDC deposits, there is no way to
draw any scientific conclusions about the   previously GenBank accepted
 Advanced laboratories DNA sequence  deposits from Human borrelia Culture
 positive DNA sequences.
 
The CDC  position  is scientifically Untenable, in this matter/
 
If I do not hear from you promptly, I shall escalate this matterto
the the US Senate Oversight Committee for the Centers for Disease Control
for  investigation  of the possibility of Scientific Misconduct.
 
No Investigation will be forthcoming if:
1 .Johnson et all RETRACT their manuscript from the J. Clinical  Microbiology
2. The Director of the CDC issues a Press Release, with a Public apology 
    for a CDC Flawed  Science  publication in an  international
     Academic Journal { Journal of Clinical Microbiology}
 
 
Yours truly
 
Alan B. MacDonald, MD Fellow of the College of American Pathologists
 
I am sending copies under separate cover  of this letter to:
 
Sen. Kristen Gillebrand,  New York
sen. Richard Blumenthal, Connecticut



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Poppy, bear with us, I truly think we should allow the Swine to stay here and expose himself further.
(Metaphorically speaking, of course, not physically - we have enough horror in our lives.)

He has already shown himself to be a Coward, cutting and running and attempting to delete all his past messages.

I see he is now attempting to do that not only here, but on many other forums where he had been pretending to be a Lyme patient too.

Did you have a chat with your lawyer Ed?

Poppy we can all take a vote on this if we have to, but now that he is back, I would like him to stay.

He is our prisoner!!!

The longer he continues to play his games here, the more evidence piles up, the more he reveals not only his corruption but that of all his evil colleagues too.

And we can and SHOULD archive every single word, as we will need it all later to present to journalists and congressmen and MPs in my country and lawyers etc etc..

I know many people will find it distressing. If it's too much for anyone, just close the thread. I am used to Ed's antics. He has been harassing me on and off for nearly ten years now.

His cute remark about "cultist" was aimed at me. That's probably the least vicious libel he has ever aimed at me.

He's been here many time before, Poppy, and each time, eventually people here realise, and alert our good moderators and they kick him off as a "troll".

But Ed is much much more than just a "troll", and he needs a punishment a billion times more severe than just being kicked off an internet forum.

He needs to be exposed, as do Barbara Johnson and the others.

So please, Poppy, try to bear with us.

Elena


quote:
Originally posted by poppy:
Hey moderators, why is a troll being allowed to stay here? Please ban this guy. No patients should be exposed to continuing abusive behavior from someone who calls them cult like. Get rid of ihcTom!!!!!



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
So Ed is back.

And this time, he is not pretending to be "LHCTom" or "Tom Eames" anymore.

Fascinating, Ed. Are you trying to convince us that you are NOT a coward? If so, then why did you delete all your posts?

Why are you frantically deleting them right now from all the other forums where you have been pretending to be a Lyme patient?

Why did you call yourself "Thomas Eames", Ed? Were you trying to impersonate the good engineer in Norfolk by that name? No, I think not.

Were you pretending to be Tom Eames, the TV personality who works for Digital Spy?

Now that's a possibility.

"Digital Spy" is a massive internet media network owned by Hearst. Did you see yourself as a Digital Master Spy?

Did we rain on your parade, Ed?

Has the Digital Spy come in from the Cold?

Well, as you like TV and entertainment and pretending to be Tom Eames, let's all play Celebrity Big Brother, shall we? After all, we have two celebrities here.

We have Dr Macdonald, the greatest Lyme scientist in the world.

We have a house full of 41 700 or so people whose lives were destroyed by Lyme Denialism.

And we have an arch-Denialist - you, Ed.

Welcome to the House!

There's the sofa - please take a seat. Someone bring the man a drink!

No, put the strychnine back - we're going to give the swine a chance to prove he's not a coward.

It's not so brave to admit your first name is Ed. After all, you could be ANY Ed, couldn't you?

Edward Kennedy?
No, I don't think so.

Eddie Murphy?
No way.

Edward the Confessor?

Well, it remains to be seen.


Elena

--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
lhctom
Member
Member # 41709

Icon 1 posted      Profile for lhctom     Send New Private Message       Edit/Delete Post 
[group hug] [toilet] [toilet] [toilet] [group hug] [bonk] [bonk] [bonk]

"A horse is a horse, of course, of course,
And no one can talk to a horse, of course,
Unless, of course, the horse, of course,
Is the famous Mr. Ed!"

http://starkravingviking.blogspot.com/2006/08/lisa-masterson-of-uk-victim-of.html


http://www.actionlyme.org/SWEEG_STALKING.htm

Posts: 15 | From CA | Registered: Aug 2013  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
First of all, Ed, have the decency to hit the "Reply" button. Otherwise your posts look very confusing and my post beginning with the words "After being exposed and dealt...." appears to be coming from you.

I do not want to be confused with you.

Now Ed, you say you are our "friend".

Do you have a computer virus that inserts the letter "r" in random words when you type?

Well, maybe we should take Ed at face value. Maybe Ed has had a heart-to-heart with himself (which is impossible, as neither have a heart)and decided that 25 or so years of causing misery to Lyme victims is enough, and it is time to turn over a new leaf.

Hello, my new friend Tom! (Sorry, I mean, "Ed".)

So, maybe our new friend Ed is trying to help us with that cryptic message about delusional disorder and paranoia and stalking etc.

What oh what could he be trying to tell us?

Is our new friend trying to warn us about someone who has delusions? And if so, who could it be?

Well, it could be Dr. Barbara Johnson, at CDC.

After all, a "delusion" is a false belief,rigidly held, in the face of all reason and evidence to the contrary.

So, now that Dr Barbara Johnson knows that there were TWO separate labs involved in Dr Sapi's study, one in Connecticut, and one 200 miles away in Pennsylvania, if she STILL believes that the lab strains of Borrelia walked from one lab to the other to contaminate patients' blood cultures, then yes, I think most psychiatrists would accept that she is delusional.

Paranoia? Is Dr Barbara Johnson of CDC paranoid that if Advanced Labs culture test were to be accredited, tens of thousands of tests would be performed, and it would no longer be possible to sustain the fiction that chronic Lyme does not exist?

If Dr Barbara Johnson is not paranoid, why can't she allow an open scientific debate?

Why did she need Ed, the Monster from NIH, to create a fake persona as a suffering Lyme patient, cultivate it for a year, then use it to try and convince real patients that the new test is a dud?

Why does she need Ed to hack people's Medscape accounts?

Medscape is the largest medical portal in the world. Literally millions of doctors around the world read Medscape.

If you subscribe to Medscape, you are allowed to post comments to news items. Does anyone see any comments opposing the fraudulent CDC article attempting to discredit Dr Sapi?

I tried to post one and it was deleted. My account and others were hacked recently. what did we have in common?

We were all talking about Borrelia, and none of us were denialists.

Medscape moderators did undo some of the damage that Ed and his criminal friends did to our messages on an Alzheimers thread.

But as far as I'm aware, it's still impossible to post any comment disagreeing with the CDC article on Medscape.

Why?

Certainly, CDC has enormous influence with Medscape, and even have their own news section there.

The Denialist Dr Paul Auwaerter is head of Infectious Diseases at Medscape.

Are Dr Barbara Johnson and the other Denialists paranoid about what would happen if they allowed an open scientific debate, rather than using criminal methods, and "Tomfoolery" like Ed has just done, to enforce their view?

What about stalking?
Now, I may be wrong, but somehow I don't visualise Dr Barbara Johnson as on online stalker.

And why would she need to be one, when she has such an excellent one already - Ed!!!

Because after all, Ed, if truth be told, you have done more "online stalking" than most people have had hot dinners.

and a fair bit of "OFFline stalking" ie REAL LIFE STALKING too. Haven't you, Ed?

Ed has stalked and harassed people right here on LymeNet, haven't you, Ed? For example, Tincup, a very popular and respected member of LymeNet for years.

Ed usually uses false names when he libels people, like the literally thousands of libellous messages he and his pathetic little gang wrote online about me, calling me everything from "insane" to "drug addict" to "prostitute" to "embezzler" etc etc.

But that was back in the day, wasn't it Ed. Nearly ten years ago now. You see, me and "friend" Eddie here go back a long way.

At that time Friend Eddie used to PM me practically everyday, several times a day, to insult and harass me and occasionally to send me death threats like "Cars come up on the sidewalk." This went on for months on end.

Now normally, Ed does this kind of thing under one of his myriad false names. But he did use his REAL NAME to threaten to drive down to Tincup's house and "punch [her] in the face".

Maybe he really did drive down to her house?

Did you Ed?

I would like Ed to drive down to my house. Why? Because I live on a different continent to Ed. And though he could afford a pretty nifty car with all that American taxpayers' money he is paid
at NIH, still I dont think the car would make it across the Atlantic Ocean.

Elena


quote:
Originally posted by lhctom:
One of two things has happened.

1. After being exposed and dealt a stunning blow by Dr Alan Macdonald, the Monster from NIH has turned tail and fled, like the coward he is.

or

2. Our good moderators, seeking to protect us from frauds and con merchants, have realised that he is back here for the nth time, pretending,yet again, to be a patient.

And though Ed still has a position at NIH, and still retains respectability as a member of various prestigious scientific societies like the American Association for the Advancement of Science (A.A.A.S.). our good moderators have understood what a hateful fraud he is, and slung him out right on his A.A.A.S..

Regardless of which has happened, I would like to make an URGENT request, not only of the moderators, but of every person here, whether you have participated in this thread, or merely read it:

Please SAVE any files you may have showing what he said on this forum.

Please SAVE them both in electronic form, and in HARD COPY.

Moderators, please RETAIN any technical, server-based or other data in any form that you may have, that might allow the origins of his messages to be traced.

Please everyone SAVE this material, and STORE it SAFELY. Because one day it could form part of a huge dossier of important evidence of the FRAUD perpetrated by US government scientists, and their colleagues in other countries such as mine, fraud that has resulted in the suffering of MILLIONS of people.

I know I joke a lot and use a lot of sarcasm. But I am deadly SERIOUS about this point. Things will never improve until all these morally-challenged Denialists are EXPOSED.

Elena Cook

Paranoia is a delusional disorder characterized by the dominance of one delusion or false belief without any other sign of mental illness. The person’s behavior depends on which delusion they have. For example, a person who has a delusion of persecution believes that other people are spying on them or plotting to harm them in some way. Online bullying and manipulation of others can be a result of a delusional paranoid disorder – for example, the person believes they are being stalked online as part of a conspiracy and accuse anyone with a different opinion as being the “stalker” and an agent of the conspiracy. Fears are described as paranoid when they are rigid and exaggerated and not based in fact. They are unable to consider opinions divergent from their own. It becomes a progressive personality disorder of delusions of persecution with extreme grandeur and is strenuously defended with convoluted logic and reason. It includes systematized delusions ascribing hostile intentions to others often driven by a sense of a mission. They are easily offended, readily assign harmful meanings to other people’s views and quickly become hostile, aggressive and argumentative. They often collect weaker personalities around them forming a dangerous cult that further drives their delusions.

best regards,

Your friend Ed



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
Why are you posting multiple icons of toilets, Ed? Are you so frightened? Why not just your change your clothes and have a shower and come back here?

There is a bathroom in the Big Brother House.

Frankly Ed, no one's interested in your attempts to guess my name or personal details, or to smear me by associating me with right-wing extremists or nuts who believe the Lyme coverup is organised by Jews, giant lizards from outer space, or non-existent Communist regimes in Russia post-1991.

Some of these nuts may post my articles on their website. And of course some of them are paid to get involved in the Lyme movement and discredit anyone who writes about the coverup and make us look ridiculous. Paid by the same sources that pay you!!!

Tell them your surname, Ed, you coward. Tell them who you are, and how hard you worked to create misery for everyone.

Elena


quote:
Originally posted by lhctom:
[group hug] [toilet] [toilet] [toilet] [group hug] [bonk] [bonk] [bonk]

"A horse is a horse, of course, of course,
And no one can talk to a horse, of course,
Unless, of course, the horse, of course,
Is the famous Mr. Ed!"

http://starkravingviking.blogspot.com/2006/08/lisa-masterson-of-uk-victim-of.html


http://www.actionlyme.org/SWEEG_STALKING.htm



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
lhctom
Member
Member # 41709

Icon 1 posted      Profile for lhctom     Send New Private Message       Edit/Delete Post 
One of two things has happened.

1. After being exposed and dealt a stunning blow by Dr Alan Macdonald, the Monster from NIH has turned tail and fled, like the coward he is.

[loco]

or

2. Our good moderators, seeking to protect us from frauds and con merchants, have realised that he is back here for the nth time, pretending,yet again, to be a patient.

[confused]

And though Ed still has a position at NIH, and still retains respectability as a member of various prestigious scientific societies like the American Association for the Advancement of Science (A.A.A.S.). our good moderators have understood what a hateful fraud he is, and slung him out right on his A.A.A.S..

[sleepy]

Regardless of which has happened, I would like to make an URGENT request, not only of the moderators, but of every person here, whether you have participated in this thread, or merely read it:

[confused]

Please SAVE any files you may have showing what he said on this forum.

[group hug]

Please SAVE them both in electronic form, and in HARD COPY.

[toilet]

Moderators, please RETAIN any technical, server-based or other data in any form that you may have, that might allow the origins of his messages to be traced.

[loco]

Please everyone SAVE this material, and STORE it SAFELY. Because one day it could form part of a huge dossier of important evidence of the FRAUD perpetrated by US government scientists, and their colleagues in other countries such as mine, fraud that has resulted in the suffering of MILLIONS of people.


I know I joke a lot and use a lot of sarcasm. But I am deadly SERIOUS about this point. Things will never improve until all these morally-challenged Denialists are EXPOSED.

[puke]

Big Eddy M

http://web.archive.org/web/20030625044352/http://qis.net/~edwardmc/

Posts: 15 | From CA | Registered: Aug 2013  |  IP: Logged | Report this post to a Moderator
Eight Legs Bad
LymeNet Contributor
Member # 13680

Icon 1 posted      Profile for Eight Legs Bad   Author's Homepage     Send New Private Message       Edit/Delete Post 
"Big Eddy M", (formerly known as LHCTom and "Thomas Eames", the phony Lyme patient persona created to discredit Dr Sapi's culture test), you are not so big and bad as you think you are.

I asked you to have the guts to admit who you are. Well, you still have not replied properly. You are still playing games. Are you hoping that one day at a hearing or tribunal or Public Enquiry you will still be able to deny it is you?

You posted the link to your old website, that's true. Yes, it is genuinely his website, preserved forever by the "Wayback Machine", which is an internet archive which crawls the web a bit like Google, and stores pages in case they are deleted and lost to posterity.

Of course, you did delete your website many years ago. And if people go to this link and look at the content of that old website, and compare it to the things you say these days (I mean the things you say using your REAL name, not as "Tom"), then they may be able to work out why you deleted it.

They may be able to work out just what you and so many of your colleagues are trying so hard to conceal.

But many people here might be afraid to click on a link you post, in case they get a virus, or have their machine hacked, as these are typical "Ed" tricks, aren't they?

Personally, I think it should be quite safe to click on that particular link, as it does not lead to his website, (which is deleted from the Web, just like most of his posts here )only to an archived copy of it.

Ed is very good at deleting things in a tearing hurry. How many times have you had to replace the "Delete" key on your keyboard, over the years, Ed, from overuse?

Well, putting a link and signing off "Eddy M" is a little bit of progress, but still not good enough.

Stop playing silly games and sign your name like a man, Dr. M.

Elena


quote:
Originally posted by lhctom:

[puke]

Big Eddy M

http://web.archive.org/web/20030625044352/http://qis.net/~edwardmc/ [/QB]



--------------------
Justice will be ours.

Posts: 786 | From UK | Registered: Oct 2007  |  IP: Logged | Report this post to a Moderator
lax mom
Frequent Contributor (1K+ posts)
Member # 38743

Icon 1 posted      Profile for lax mom         Edit/Delete Post 
This is all very creepy and just plain weird. No other disease has this sort of dynamic playing out.

Can you imagine a so-called Dr pretending to be a cancer patient on a cancer forum just to incite the other patients and make fun of their suffering? Truly sick.

What goes around comes around.

(Even creepier: this post was my 1666th I guess the troll is truly the devil)

--------------------
♥ ♥ ♥ ♥ ♥
(aperture)
http://flash.lymenet.org/scripts/ultimatebb.cgi?ubb=get_topic;f=1;t=115161;p=0

Posts: 2519 | From USA | Registered: Aug 2012  |  IP: Logged | Report this post to a Moderator
   

Post New Topic  New Poll  
Topic Closed  Topic Closed
Open Topic   Feature Topic   Move Topic   Delete Topic next oldest topic   next newest topic
 - Printer-friendly view of this topic
Hop To:


Contact Us | LymeNet home page | Privacy Statement

Powered by UBB.classic™ 6.7.3


The Lyme Disease Network is a non-profit organization funded by individual donations. If you would like to support the Network and the LymeNet system of Web services, please send your donations to:

The Lyme Disease Network of New Jersey
907 Pebble Creek Court, Pennington, NJ 08534 USA


| Flash Discussion | Support Groups | On-Line Library
Legal Resources | Medical Abstracts | Newsletter | Books
Pictures | Site Search | Links | Help/Questions
About LymeNet | Contact Us

© 1993-2020 The Lyme Disease Network of New Jersey, Inc.
All Rights Reserved.
Use of the LymeNet Site is subject to Terms and Conditions.